TTHERM_00011640

Length: 3402 bp

cDNA Sequence

ATGAAATCAATACTTAAAAATAATAATTAGATTACATTTAGTGAAGAAAACAGAGAAATTAGAGCTAATCTTCTTTCATATCAAGAAAGGTCTGAAGATCATGAGGAGTCAAAAAATAACTAAACTGTTTAAGGCAATAAGACTATATTGTACAATCCTTACAGAAATACAGTAGATACTACTATGATTAATGTAGAAGAGTTTAATAGTTAGAAGCCTTTAGATGTTTATTTAATGACTTCGTTCGATGAAAAAGGCTAATAAAGAAAACCAGGTCTTCTCATATGCAAGCACCCTCATTTAAAATTAGATAAAAGGACCTTGTCAAATTAGAATAACAATAAAGCTCCTAAATATGACAAACAAAAAAAATATTATCCAACATTCGACGAAGAAACTGGTTACTAAGGTCGCTTATTTCCAATCGACACCGAAACAGGCAAACATGGACTCCTTTCTTATTACTCTAAGTAAGTGAAGGGTTTCGATAAGATTAAAATGTTAGTCTGTGTTACAATGTATGCGGAAGAGAGAGCTTTCTTAGAGAATACTTTAAGACACATTTATAATAACATAGAATTTTTTGAAAAGGAAGCTGGTGTTCATCAAAGTCAAATTGCTGTGGTTGTTTTACAAGATGGTATAATGAAAATGAGGTAGGAAACTGTTGATTTTTACTCCCATATAGATGAAAGCTTGAAAAGACCTTGTCATCTTTAAAACCGTAGGAATATAATAGATTAACAAATAAAATTCTTGAAATACACAAAACAAGAAGCAACTCTTGAGTCTAATCAAAATTTCCCTAATACAATTCCTGCAAAAACTACTCTTCTCTATTAAAACCAAATTTAGTTCAATGACTTAAACGAATTAAAGGTTAATTTGGGTGATTAAAATTTTGACCAAAATCACATGGACACAACAAAAAGTGGCTTAATTGTTTTTTCTGCTTTTAAGCATTTGAACTCTAAAAAGCTCTCCTCGCATTTATGGTTTTTTGAAGGTTTTTGCCAATAATTTAAGCCTAAGTATTGTGCATTAGTTGACGTCGGTACACTTCCTGCAAAAGATGGACTAGTTAAATTCTACATGGCCTTAGAAGGAAACGATAAAATTGGAGGAGTTTGTGGATTTTTGGGTTTAGAAGAGCCATAGATTGGTGAAGAAAAAAGTGAAAGAGAAATGATGGCTATCTAAAAAGAAGCTGAAAAAAAAATCAAAGAACAAAAGAGACTAATAAGAGATGAGTGGCAAGACCAAAAAAAAGAGAAAAAATAAAACCAAAAAACTCATATTCAACAAAAAGTAAATTAAGAAGATGACTAAAAATAAAAGTCAGAGGAAATAAGAATAGAAAAACTAAAGAGAATTAAGGATACTAAGAACAAAGTTAATTTAAAGATTCAATTAATTCTATTTCCAATTACTCTTTTATACATCATCTTTAAGAAAATCCTATTTGATTTTATCATCTATAACATTTTTTGGTTTATTTTTAAAATCATTCAATATACTTTACTTGGTTTCTTGCGCTTAGGTAGTTTGAAAAATGCATAACTATATGAGTACACAATTGCTCACATGGTTGATAAAAACTTTGAATCTTTGTTAGGATTCTTGCATGTCTTACCTGGTGCTTGGTCTGCTTATAGATATGAGGCACTACAAGTTAAATTTGAAGGTAGAGAAACTATTTTACAGAAGGCTTACTTCAAATAATTATTAAATCCAAGAAGACTTGAGGGTAATATTTATGAAGCTAATATGTTTTTGGCTGAAGATAGAATTCTCTGTCTAGGTTTGTATTGCCAGCCTCAAAAAGATTATATCTTAAAATATATCCCAGATGCTTATGCTTTTACTGATCCTGTAGGAACATTAGAAGAATTCATGAGTTAAAGAAGACGTTGGATAAATAGTACAAACTATGCCTTGGATTATGTTCTGAAACATTATAGAGGTTTTGTTGAGGATAGTGGTCATACTTCTTTATAGAAAAAGATTATACTTCCTTTTAATATGTTTTTTGCAGCTTTGGGTAAGTTTAATACTTACATGCTTCCAGCTTTCTACATTTTTGTAGCAATTATGTGCAGCTACTAGTTTTTAAATCCTGATCTATAGCAAGGCTACTAGCTTTATGTAGATGAAAATAAAACAGAAAAATGTTAATAAATGGATACATAACCAGATGATTAGATGTGCAATCCTTTAGTAGAACTTAAAAAATAAACTCTTTGCTATTAAATTTGTACAATTAAAGATGATCCATCATTTGCATTAATAGCCTTGAATTTGATTCCTGCAATCTTCATAGTTTGCATTCTATGCATTATATTTGCAAGTTTAGTTTTGAAGGTTAAAGGAGGCAATAAACAACTATATAATAAAATTATAGAATAGAGCTTGGAAGATCATGAGCTTAATGAAATTGGTAGACTTAGAAATGAGCTAGAGCAGAAGTTGTAAGATGAAAGATCTAGAAACGCTGCTGTATAAAAAATAAGAAAAATAGAAATACAATATGAAAAAAAGATACATGACATAAAAGAGAGAAAAGGAAATTATACAATTAGAGAGTTATAAGAAATTAAACAAGAGAGCATTCACACTTTAAAGACAAAGAAATTCGAGCTTAAAAAATTGGTTGACTAACTTAAAACTCAAGAATTTGGTATGACTGTGTTCAAGGTTCTTTCTGCTATCATCTCAGTTAGTTCTTTGCTAATTGCTGGTATTGTTTTAGTAAGCGTAGCACTTAATATTTACAACAGAAAGAACAATGTTATAGTTGGCTTTAAAGAGCTTGATAATACCTTGTACTGGTATATCATAGCTCTTTTGGCTACAAATGTTGCCAGTTATGTGATTATTGCCGTTGTTCATATCTGCCCTCAATACAAACTTGTGTGGTTCATGTTTAAGTCATGGTTTAGTTTCACCATTTATTAGCCTATATACAATCATGTCCTTTTAATCTATGCATTTTGTAATGTTGATGATGTTACATGGGGAACAAAAGGTATCGGCAAAGACTCTGAAAAGACAAACTTTTATTTAAATAAAGTTTAGTTTGTTGGTAAATGGTTATTGTTAAATGCAGTTTTCGTAACACTGCTAATATCAGTCAATTTATTCTTTGCTTAGACTCCCTACGTTATGCTAGGAATAGGTACATATGGTACATCCTATCTTGCTATCAAGAGTATATTGGCAGCAGTTAATTATCTCAGATACTTTTGCTATGAAAAGAAAAAATATTATAAGAAAGTTACTCTTTATAATACTAATTTTGAAAATCCTTCTGCTAAAGCTGCAGCACTCTAAGAATTTGAAGAATTCAGGTTAAGAGGAGGTAGATAATACAGAGAGTCTAATTTATTACAAGATTTAAAGTGA