TTHERM_00013290

Length: 1122 bp

cDNA Sequence

ATGAAGATCAACATTAAGACTTTAAAGGGCACTGATTTTTTTGATGTTAACCTTGAAGAAACTGCTACAGTTGCTGAATTGAAGGAGAAGATTGCTACTGAAAAGTAAAAGGAAAAAGATACTATTAAGTTAGTTCATAAAGGTAAATAATTGACCGAAGACTCTAAGACTCTTGGCGAACTTGGTATTAAAGATAATGATTTTGTTATTCTCATGTTCTTTTAAAAGAAAGCAGAAAAAGAAGATGCTCCATAATAAGCTTAATCTGATACCACTTCTACTACCTCCGCTGCCTCAACAACTGCTACTAACCCCACTACTGTTCCTAAGCCTGCTGTTTCCTAACCCGCTACAACATAATAAACAGGAAGTTAAGGAACAGGTAGTGATCTCCTTTAAGGTCCTGAATTGGAAGCCAAAATTAAAGAAATTGAATCAATGGGTTTTGAAAGACCTAAGGTTCTTTAAGCTTTGAAGGCCGCTTATTACAATCCTGAAAGAGCAGTTGATTATTTACTCAGTGGTAATATTCCTAAAGAACCTAGTTAATAATAGAGTCCTTTACAAGGCTTACAAGGTCCTGGTGTTGAATAATTAGCTTAATTAGCTTAAAATCCTCAATTCCAACACATTGCTTAAGCTATTCGTTAAAACCCTGCTCTTCTCCAACCTGTCATGTAATAATTAGCTTAAACTAACCCTGATGTTGCCAGACTTTTACAATAAAACCCTCAAGCTTTCTTGCAACTCCTCCTTGCTGCCTCTGAAAACGAAGGTGGATAAACCTTACCTCCAAATGCCATCCAAGTCACTCCTGAAGAAAAAGCTGATATTGATGACATTATTTCTATGGGTTTTGATAAAAATGACGCCTTAGAAGCATATATTACCTGCGACAAGAACAAAGAATTAGCAATTAACTATCTTTTCGAAGCAAGGGAAAGCGGTACTCTTCTTTCTGAACACATCCAAAAGGAAGAATTAGAAGCTGCATAATAATAATCATAAAACTAAAATTAATAACAATAAGGTAATAACCCAAATCAATAATAATAATAAGGTGGATAAGGTGAAGGTGGTGATAATGATGATGAAGATGACGATGATTTTATGTATTAATGA