TTHERM_00016360

Length: 1275 bp

cDNA Sequence

AAACAAAATAAAAAGATTGAAATAATAAAAAAAGAAAAGGAAAGAAGATCGAATCCGCAAATGATTTCAAAAACCTAGGCCTTCGCAAGATTATTCCAATTGAGTTCAAAATCATTCTCTACTGTCAAGGGTGGAAATTTATACACTTGGGGCTAATACGCCAGTGGTACCGGTTTCGAGACCGCCTCTGCTGTCCCCAGAAAGGTTGATTACTTCTCAGGCAATGTCTCCAAGGTTGCTATGGGTCCTTATCACACTGCCGTTATTACCAACGACGGTTCTTTATACACTTTTGGTTGGGGTTAAAACGGTGCTCTCGGTAATGGTGCTAAGGAATTCTAATTATCTCCCAGCCCTGTCAGCTTCTTCAACGATAAGAAACTCAAGGTTAAGGACGTCGTAGTTGGTGAAAGCTACACTATTGCCGTCACTGAAAATGGTGAAGTTTACTCCTGGGGTTATGGTGGTGAACCTTCCAGCAAGATCAACCTTGACTTCTTCAGAAACGCTATTTTACCTCAAAGATGTGGTGCTTTGGGATCTGGAGATAACAAGAATAGATTAACTCCCTAATAAATTGCTAACTTGAAGGCAGACGGATACAAGAATATTTCTGGTGGTGACAACTTTGCTACTTTGGTCAATTAATCTGGTGAAGTTATTAACTGGGGTACTGGTCTTTTCGGTTCTTTGGGTAACGGAAGCGACTATCCTTTATTCACTCCTGAAGTTAACGCTTACTTCAAGCACTTGAAGGAACACGAAGGACTCACTGTTTAATCCATTAAATCTGCTGGTCACTTCTCTGCTGCCTTATTATCTAACGGTAAATTATACACTTTCGGTGTTAACACTCAAGGCTAATTAGGTATCCGTGAAAACCTTGGTCACAACACTGACTAAAATGCTCGTCTCCCTACCCCTGTTGTTGACAGACACTTTGTTGGTCAAAAGGTTGTTGACTTCGAAGTTGGTGAGAACACCCTCGTCTTCCTTACTGATAAAAACGAAGTCTTCTTCAGTGGTTTGGAATTAGCTTATTAACCCATCAGATGGGAAATCCCTACTGACAAGAAGATTGTCAAGCTTGCTGCCTCTAAGGACACTTTTGCTGCCGTCACTGAAACTGGTAAAATTTATTAATTCAACGAATTCGTTGGTGTCTCCACTAATGAAGTTGGTAACGATTACAATGTTGCTGATAGCAAGGCTTTCGAAGGCAAGGTTGTTGATCTTGGTGGTTCTTATGGTATTAGATTTGCTATTGTCAACTGA