TTHERM_00024260

Length: 1119 bp

cDNA Sequence

ATGAATAGCACTAAGACTTTGCATGACTCTGTTCAACTAGGTGAACTAAAGCTCTAAAATAGATTTGTTGTAGCTCCTTTGACTAGATAAAGAGCTGATAAAGATTCTTTTATCCCAAACGATGTAATGAAAGAATATTATACTTAAAGAGCATCTTTCGGTCTGATTATTACAGAATGCTCCTAAGTTTCTAAGTTGTCTGATGTTTTTTATTGGAGTGGTGGAATATACAGCAAAGAATAAGCTTTAGGTTGGAAAAAGGTAGTTGATTCAGTTCATGAAAAAGGCGGATTAATCATGCTCTAAATTTGGCATTGTGGAAGATCTGCAAATATAAGCTAATTAGGTGGAAAGCAACCTATTGCTCCATCTCCTATAGCTATTAACTATAAAAGCAGAGCAACTGGAGAAGACTATCCTGTACCTCATGAGCTCACAATTGAAGAAATTAAAGAAGTCGTCTAATAATTTAAGCAAGGAGCAATTTATGCTAAAGAAGCAGGATTTGATGGAATCGAATTGCATGGAGCAAATGGTTATTTGGTTGATTAATTTTTGAGAGATGGCTCAAATAAGCGTACTGATATTTATGGAGGAAGTCCTGAAAACAGATCTAGATTCTGCCTAGAAGTTATAGATGCTCTAGCTGAAGTTTTTGGCTATGGTCGCACAGCATTAAGAATATCCCCAACTGGTAGATTTAATGATATGTATGACTCAGATCCAGTAGGACTACTCAGTTATTTACTTCCTGAATTAGATAAAAGAAATCTTGCTTTTGTTGAGTTCAAGAGGCATGGAGCTCTTGAAAATAGAGCTGTAGTTTATCCAGATAGAAAAACTCCTTAGGAATAAATGCCAGATTTCTTCAGAATAATTAGAAAATTATATAAAGGAAATATAATTGCAAATGATAATCTTTCGATTGAAGAAGCTTAAGAATTAGTTTAAGAAGAGGTTGCTCAAGCTTGCTCTTTTGGATATAAATCAATCAATAATCCTGATCTACCACTCAGAGTCAAAAATGGCTGGAAGTTAAATGAAAATCTTGATAGAGATACTCTTTTTACTTAAGGTCCTAAGGGTTATACAGATTATCCATTCCATAATTAAGAGTGA