TTHERM_00024330

Length: 288 bp

cDNA Sequence

ATGGTAGAGCTGAAGAGCGGTGATACTTATATTGGAGTTTTAGAGGATGTAGATAGATTTATGAATATACAATTAACTGAAGTGACATTTACTTCTAAAGATGAGGCCGTCATTGACAAGGCTATTGAAGAATAAGAAATATTAAATGAATAAAAAGAAGAGGCTAAGAATAAAATGAAGCAAAAGAAGGAGGGAGCTGCAACACAAGAAAAGGATGGAAAGCAAAATAAAAAGTTCGAAAAAAGTAGAGGAGGTTATAAGGGAAAGTCTAAGCCAAGAGGTTCATGA