TTHERM_00028470

Length: 2061 bp

cDNA Sequence

ATGAGATCTTTTAAGTTGTTTATTTTAGTTTCCTTAGCTATTTTCGTTTTAATGAGTAGCTCTAGGTAAGTGAATGCTGAACTTGTAACCATAACATAGTTTAGTGATATAGCTGATAAAGTAAGAAGCAATCCTAATTCTTTATCTGCGATTATGGTAACTCGTTTAAATTAATGTGAAAGATGCAATGTCGGTGTTAAAGTTTTCAAAGAATATGCTGCTTTAGTTGATGGAGTTGTTCTTACTTATTTAGTAGATTGTGAAAAAGTCTGGGAAAACTTTGAAGACCAACCAAGAATTCCTGCATGTGACCCTGAAAAGAAAGATTAATTACCTCATATTACTTTCTTCTAACCAGAATCTGATGAATTAGACATCTATAATAAGAAAAATAAAAAACTACCTAAAGATGTGCCCTATTAAGGTATGGTTAGTCCGGATGCTTTAATGCAAAAGTCAAAAGAATTGCTTCCTTCTTTTATTAAGACTATTTCTAATCCCAAGGACATTGACAACTATTTAAACTTTAAAGAAATCCCATTAAAGTTAGTTCTTTTCACAGATGAGGAATAACCACCTCTATTTTTACGTGCCTTAAGTGGACAATATCGTGGCTAAGTTGATTTTGGTTTAGCTGATGTTGACAATAGAAAGCTTAAAAAAAGATATAATGTTTCAAATTTCCCACTTCTTATAGCATTAAAATTATCAGGCACTGATTATGAAAGGGCCGATTTCAGTGGTGAATTTACTGTCCCAGCTGTTGCTTCTTTCATTTAAGAATAACTTAAATCTATGCAAGTTGACAAACAAAACACCAAATAAAATTAAGGAACATACTTTGATATTCCCGAAAATGTAGATGTCCAAGAGTTAAAACCAGGCTAAATTCTTGCAGCATTGAAGAAATATAAAGAAAATTTCGTAGCCTTCCATCTTTAGAAAGGAAAATCTTCTGAAACTGCTTAGATTTTTGACTAGCTTAAATAAGATTTCGGCAACATGTTTAAGTATTACTAAGTTCAATGTAATGCTGAATGCAATGAAATTTTTGGTAGTAGCTTATCAACCTATCCAGCTGTGATAATTTACCCATTAAGTGGAACTAGAAATTAACAATAATTTGTTAAAGTTAACAAATATGATGACAAAAATGATTTATCTTCAGAAATTCTAAACTCCGTTTTATACAGCAATTTAGTTGAAAGTGAAGTGGAAAATGATTAAGATGCAAGAAAGAAAATAAGAGAAGGGCTTGATGGTAAAAAGTATTCTGTAATTTTAGCTCATGATAAATATGACCACTATCAAAAATTGATCTTCTTTATAGTAACATAGCAATAGCGTTTCCGTAAATACTTGAATTTCGTTCGTTATGTTAATCCAACTTAAAGTGAAATTAAAAATTGGAGCTTAAATGGTGTTCCTGGAATCGTAGCTGTTTTAGAACTAAATGACTTTTAAAACACTTTTAGAAGATCTCCTTATGAATAAAAGGACTTCTAGTTTAAATCTGTAGTTGATTATTTAAACTAAATTGCCATTTAAAAGCAAGATGAAGTAGTTGACCAAATAAAGGTTGAAGAAATTAAAAAATAAGAAGAACTTGAGGAGAAATGTCTTCTAAATACTGAGAAGCCTTGCTTAATTGCTCTTTTCGATATGTCAAAGGAAGGTAAATTTAAGTTAGACTTAGAGAAGATTAACAAGATTAAGAAGCTTTATGCAGATAGAGATATTGGTTATTTCTATATTGATGCTAAATGCCACAGAGAGCTTTTATAATACTTTAAAATTCATGATACAAATCTTAACAGCTTAGTTTACTTAGACTAAAAGAAAACTAAGTATAGATTACTTAAGGAAGCTTTTGAACTTGAAAATCTTATCAGCTTTATGGATGACTTATAAGGCAAGAAACCTAAAGGATTAGTAGCCTTACCAGGTTCAATAGATTTGGATGAAAGAGATTGTGATGCCTTTAATGCAAGTGAAAAACAAAGATTAGAATAAGAAAGACTTCAAAAGAGCAAAAGCAAATATAAAAAAGATGAGCTTTGA