TTHERM_00030190

Length: 1050 bp

cDNA Sequence

ATGATCTCTAAGCTCTTCTAAAATACTGCTAAGTCCCTCACTGCTGTCAACAGCGCTTCCTTCAGTCACCACCACCACAAGGCTCCCGTCAGAGTTGCTGTCACTGGTGCTGCTGGTAACATCGGTTATGCTCTCGTCTTCAGAATTGCTTCTGGTGAATTATTAGGTAAGGACCAACCCGTCATCCTTTAATTAATCGAACTCCCCCATGCTTAAAATGCTCTTAAGGGTGTTGCTATGGAATTGAACGATTGTGCTTTCCCCTTGTTACGTGACATCGTCACCACTGACAGCCAATCTGTTGGTTTCAAGAATGCTGACTACGCTTTGTTGGTTGGTTCTAAGCCCAGAGGTAAAGGTCAAGAAAGAGCTGATCTTATCAAGGATAATGGTAAGATTTTCGTCGACACTGGTAAGGCTATTAACGACAATGCCTCCAGAGACTGCAAGGTTTTGGTTGTTGGTAACCCCGCTAACACTAACTGTTTAATCGCTGCTCACTATGCTAAGGATATCCCTAAAGAAAACTTCACTGCCATGACCAGATTAGATCACGACCGTGCCTTATACTAACTCGCCTCCAAGACTGGATCTTAAGTCACTGACATTAAAAAGCTCTGCATCTGGGGTAACCACTCTCCTACCATGTATCCCGATTTGACCAACACCACCGTTCACAATAAGCTTGTTGCTCCCACTTTGGACCATGCTTGGATTGATACTTTCTTCAATCCTAAGGTTGGTAAGAGAGGTGCTGAAATTATTGATGCCAGAGGTTCTTCTTCTGCTGCTTCTGCTGCCAACGCTGCTATTAACCACGTTAGAGACTGGGCTTTGGGTAGTGAAGATTGGGTTTCTATGGGTGTTCCCTCTGATGGTTCTTACAACGTTCCCAAGGGTTTGGTCTTCTCCTTCCCCGTCACCACCAAGAACGGTAAGTACTCCATCGTTCAAGGTCTTAAGATTAGTGAATACTCTCAAAAGAAGATTGATATCACTACTAAGGAACTTCTTGAAGAAAGAGCTTGCGTTGAACACTTACTCAAGTGA