TTHERM_00030300

Length: 858 bp

cDNA Sequence

ATGAAGAGGTAGTTTGTATTTACAGAAACCTAGGATTTATTCTTCAATAAGATTTGTTAGTTCCACAAAAGCCCTTTGGAATATGCATGTCTAGAAAGGAACTGCTACTCAAAAATTAGATAAATTTGCACTAAATGTGTTAGAAAAACCCATTCTAACCACAAAATAGCTGACATGACTTTGCTTATATCTTATGTAGATTAAATAAAATGTATGATTATATAATCGACTGCCCAATTTGAAAAAGGCTATTATTCTTTGCCTTTGAATATCTTTAAATCAGAAAATATTTTAAAATTAATTGAAGAGAATTATAGGTCTTATTAAAATAAGATGGAAAGTTTGATAGTAAAAATAATTGATTTATCAATAAACCTTAAAAAGTATGAGGAATTCGATTAATACAATGATATTATTAATAAATGTATCAGTTTAGTTGGCAAAAATGAACTGATTGATTTTTACTTTAAGTACATGCCAAATAAGTGGCTAAAATAGCTATAATCAAAAATAAAAAAATGCTATGAGAGTATTAAAGAAAATGATGTATTAATTAACTTCTTTGATCACTATAGATTTAATTAAGCCACCTAAAAAAAAATTCTACTTAACCTTCCATCTTATAGGGGTTTGAAATTAACAAACTTAGCAGGAGCTCAATTGGTTATAATTTAGTCTACAAAGCTTTATATCTTAGAACTAGAAGATAATAAATAAAGACTTTTAACACATGAAGTAGACTCAAAGATAAACTAAGTCTATCAATATAAATAACAATAAAATTTACTAATTACTTGTGGTTAAACTTTACCAATCTTAAGTAGCCATAAAAAATCTTAAGAAAATACTCTAGTATGA