TTHERM_00035540

Length: 3021 bp

cDNA Sequence

ATGGAATAGTCGTTGCTTAATAAATAAGAAAAGTAGTAGTCTTAACCAAGAAAAAAAAAATAAGTATTTTGCTGTTGTTTTGGCGGAGGAGACGATGTAGAAACTGATGAAGAATAACATCATCAAGAAAAGTAGTAGTCTTAACCAAGAAAAAAAAAATAAGTATTTTGCTGTTGTTTTGGCGGAGGAGACGATGTAGAAACTGATGAAGAATAACATCATCAAGAAAAGTAGTAGTCTTAACCAAGAAAAAAAAAATAAGTATTTTGCTGTTGTTTTGGCGGAGGAGACGATGTAGAAACTGATGAAGAATAACATCATCATTAAGGTTAATAAGAACCTAATTATTTTTAGCAAAATAGTTAGGATGTAAATAATACAACAACAATTCCTTGTATGAGTAATATTTCATAGCCAAATAGCGAAATCTATACAAGTTAAGGTTACGCTTAATAAAGTAAAGCTAAAAACTCTCCACAAAAAGAAAGAAAGAGAGATATGCAATCTTCTTCTCATAACAGCCGCGTGATAAAAGAGTAAGGGGAAGAAAATAATAGCAGCAGTTCAAGTAATTCCACAAATAATTAATAATAAAATTACCAAAAGTCTTAAAATTAGAACATAAATGAGTATAATACCCCTAATCCATAGTAAAATGCTATGAGTAAAAATACGTTAAAAATATAATCTCATAAAAAATCCACAGAGTAATCATATACAAATGAGCATGATACTTATTTGAATTTCGATTAGAGCAGCCAAGCATTAAATGCAGATTTAAACCATTCTTTGTAAAGCAAAAATAATCTCAAAAACTCAGTTAAGAAAGCTAAGTACAATATAAAAGCGTTTTTGTAATAATACAAGCAGCAATAAACTGATCTTTTCCATCTGTATTGTAAAAAGAAAGAAAGCTATTTATTAGTCAAAACCTTGGAAAAGAATTTCTAGAGTAACTCATTCTTGAATTCTCAGGTAAATCAAAACCCCAGCAAGCAAAGTATCTGCTAAAAAGGAGTAGTTTCTACTGATCCAAATAGTTACTTTTACAACAGAAATTTCAAAAGTGATTTTGACAGCTAATTTAATGCAATTCCTGAGCCGATTTGCTAATATCTTTCATCTAGATTAAAAAATCAAATTGTTGTAGACGCCTTTTGTGGAGTAGGTTACAATACAGTCTAATTTGCTAAAGAAGCTAGCTAAGTGATTGCTATTGATTGCAATTAGGTTAAAGTAAGCCATGCTAAATACAATATTGAATCATTCAAATAACAGCATAAAGTTGAAGTAATTTAATCTGATTTCCTTCAAATGAAAAAGTTGAAAGCGGATACAGTAGTTCTTCATCCTGACTACAAAAAATTTGATAACTCAATTTCTTCTTCCTAAGGTATTGATAATTCAATTAACCTACTTACAGAAGTATAGCCAAATCTCGTAGAAGCTCTTAAACTCTCATTTAAAATTTCAGACAGTGTTGTAATCATACTTTAAAAAAGTTGTGATATCCAACAGCTCCCTCAAGTATTAGAGCAAGCTAATTAGTAAAACAATTTATTCGCTTTTCCATATAAAAAATTCGCTGTTGAAATCGAACTAATGCATATTGACAGAAAATTCAACCTTGCTCTCGTTTTTCTTGGAGATATTGCCCAAGTAAGCAAGGAAGAAGTTGTAGAGTATTATACAAAATTATTATACGAAAGTTCAGATGTTTAAAATTAAATATTCATGAACAAGATCAAGAGTATTCTAGTGCATATAATGCATACAAGTAAAATCAAAGGAGTTTCTTAGTTAATCGAAAATTGTGAAAAATCTGTAGCCTCTCAGCAAAACAGAAAAACTTTATTCCAAGAGTTTTATGATTGCTTAAGTGAAAAAAAAGGAAGGATCAGAAGCAGTGGTAATTTACAGTTCGAAGCTGATAGTATAGTAACTACTGATAAATCACTAAAGCAACTTATAAGAGATATTGACGATATATTATCCGCTAATTAAAAAAGTAACTTTAAATCTTAAAGTCCTTCTAGTAATGAAGACTTAGGAAGTTACAATTACAAGTTTGATTTTGAAGGAAGTAATAAGTTTAATGGAAAGCCTAAAAAAAAGGCTTAATTTAACTAAAGTATGCAAGAAACAGCCCATGATAATTCTAGTAGCTAATCTCTTATTAAAAGTGCACTTACCAAGAAATAAGTAAAGGGGTTAAATAAGAACACTGTCCAACAATTGAAAAAAAGTGAGCAAAATAATAGTATAATGAGTAAAGGATTTAAAAATAGTGATTTAAGTAATAATAATTAAAATGCAGGAAACAATTAAAATAATTAAAGTGAAGATAATCTTAGCGAAAATCATAACGAATATGAATACCATACTAGTCAATATAATGATGAAGACTATGGAGACAGCATTCCTAAAATTATTTATTCTTGCTCCTACGAAACAAACTAATTAATTGATTCAGAGGGTAGTGAAAATAACAGTTTGCGTCCTCAATTCAGTAATGGAATCTACTTCAACTAATCTACTGATGTTTACGATGAATAGGAATTCAGAGCAAGCATAATGAATTTAAAAGGCGGTAGCAACTACTATGATCGCCCATTAGTAAAACACACTAACTCGGCTGGTGGAATATTAGGCTTTACAAGAGAGTAGTTCCTTAATGCAAGCATTTAAACTAATGGATCAGGAAAAGGTCAAACGATTTTAATAGGAACAAAAAGCCAAAAAAATAATGAAAGCAAAAATAATTTATCAGGATATGATGATAACATGAGTAACAATAGATCTGCATCAAAATTAAATTAATATTATTAGCAAGATTTTTAAGAAGACTGTGCTGAGTTTGACTGGTAATAAGAAGAAGGTACAGAAAATAGCTTTTAACAATAACCTAAATAGACATAGACAAAAATAAAAAATAATATCAATACTTTTTAGAATAACCCTGACCTAGATGAGTCATATAAGAATACCAAAATATAAACTGTCCCAAATAGTTTATCTTGA