TTHERM_00037050

Length: 1671 bp

cDNA Sequence

ATGAGCGAGGGAAGTAAAGCCGCTGCTGTTAAAGTAAGTACCAACAGCAAGTAGGGAGATACCTAAAATAGATCTGAAAAGACCAATGACATCAGAACCACCAACATTCAAGCTGCTAAGGCTGTTGCTGATGTTATTAGAACCAGTTTAGGTCCTAGAGGTATGGATAAGATGATCTAAGATGCTAAGGGTCAAGTTCTCATTACCAATGATGGTGCAACTATTCTCAAGCAAATGGATGTCATTCATCCTACTGCTAAGATGCTTGTCGAAATTTCTAAGGCACAAGATATTGAAGCTGGTGACGGTACCACTTCAGTTGTCGTTATTGCTGGTGCTCTCCTTCACGCCTGTGAAAGTTTATTAGCTAGAGGTATTCACCCTACCACTATCTCTGAAGGTTTCTAAATTGCTTTAGATGAAGCCCTTAAGGTTCTTAAGGACATCTCCTAAACCGTTGACTTGAAGGACAGAGATGCTCTTATTACTTGTGTTAACACTGCCTTATCCTCTAAGGTTATTTCAACTAACTCTTAATAATTATCTCCCATCGCTGTCGATGCTGTTCTTAAGATTATTGATCCCACCAAGGACACCAATGCTGATTTGAGAGATATTAAGGTTGTCAAGAAGTTAGGTGGTACCATTGAAGACACTGAATTGATTGAAGGTTTGGTCTTCACTAACTAAAAGCCCTCCTAATCTGCTGGTGGTCCCAGTAGAATTAAAGACGCTAAGATTGCTTTGATCCAATTCTGCTTGAGCTCCCCCAAGACTGATGTTGAAAACTCCGTCGTTGTCAAGGATTACACTGCTATGGACAGAATCCTCAAGGAAGAAAGAAAATATATTGCCAATCTCGTTTCCAAGATTGTCAAATCTGGTGCCAATGTTATCCTTATTTAAAAATCTATCCTCAGAGACGCCACTAACGAACTCTCTCTCCATTTCCTTGCCAAGAAGGGTATTATGGTTGTTAAGGATATTGAAAGAGAAGATGTTGAATTTATCACCAAGACCATCGGAGCTATCCCTGTTGCTCACATTGATCACTTAACTCCTGAAAAGTTAGGTAAGGCTGAACTCTGTGAAGATGTTAAGCTTTCTGATGACTCTAGAATCTTAAAAATTACTGGAGTCCAATCTAAGGCTAAGACTGTTACCATTCTCTGCCGTGGTTCTAACTCTCTTGTTATTGACGAAGCTGAAAGATCTTTACATGATGCTTTGTGCGTTGTCCGTTCATTGGTTAAGAACAGAGGTTTAGTTCCTGGTGGTGGTGTTCCTGAAGTTGAAATTTCTCAATAATTATCCAAATTATCTAGAGAAATGAAGGGTGTTAACTCTCTTATTGTTAGAGCTTTCGCTGATGCTTTAGAAGTTATCCCCTACACTTTAGCTGAAAATGCTGGTTTGAACCCCATCAATATTGTAACTGATTTAAGAAATAGACACGCTCTCGGACATAAATACGCTGGTATCTCAATCAGAAAGGGTACTATAAATGATGATATCACCACCGAAAATGTTCTTCAACCCGCTCTCGTCACCCAATCTGCCCTCACTCTTGCCACTGAATGTGTCAGAATGATTCTTAAAATTGATGATTTGAAATTCATATAAATTTAATCTATTCTTCTTATCTGCATTATCAATAATATTAAAATATGA