TTHERM_00037140

Length: 4092 bp

cDNA Sequence

ATGGAAATACAATATAATGGAGCATCGGCAGCAATGAAGACAAAGCAAGGAAAGAGATCAAATAGTAATAGCAAAGCGAATAGTTGTAATTAACAAACCCAAAACAATAATTTACATACTCAAAATATTAGCGCAGAAACAAAAAATGAGTTTTCTAACCATGAAATTCTACTTTTAATTGATATCAGAATTAATGAATTAAATTAGCTCTCTAACATTTATGCGATGACTTTTGATTAAACTGTCAAGAAAGTTATTGAATTTTCCAACATCGAAATCAGTGATGATAATAGATGTGTTAAATTGGCTTAAGCTGTAGCTCAAATTAATAATATCAGGAAAAAATACTCTTCTTGCTAGTCCTTTTTCATAGTTTATCCAAAGAAATCCATAGCGAGTGCTCTTTTCAAAATATTTCGCCAAAATAAAATCTAAGTAAATGAATTAAGTTTCACTAATACATTCATATCCTTAGGATAGCTAATGCCAAGCTAATTTCTTGCTGATGAAGTGATTCTATTCAACTAGCTTTCATACTTTTTAGATTTCCAACCTGATGAAGAATTTGCTCAAGAGATTCTTCCAGTTTACTAGACAATATAAGAAAGCATTAGCAAAGATTAAGTGAATACTTTGCCTAAATAAATAACAAGAACTTTTAGCTAATCAATTGATTTGCATGGCCTTTCATCATCAGAGATAAAGCAATAACTGAATGGTTAATTACCAAATGATAGTAGGAGTTAAATGTTAATCAGCACATGCAATTAGCCAATAATAAAAGATGAAATAAAGTAAGAGAGAAAGCAAGATGAATTTAATGAACAGTAGAATGAAATTATTTTATCTTCTTCTTCTATTACTAATCAGCATTATTAAATGTAACCATAAGCACTTTCAAAATCTTCTTCCCTTCTCTCTTCGAATCAAAACACTCCTACTCTTTCTTAAAATCTAGCTGTAAATGTAGATAATACTACACCATCTTCAACTTTGACTGCATTTTTGAGAAAAGGCGACTAACAAAGTGAATAATCCTAACAAAATACAAGTAAAAATATATCATCTCTTTTCTCCTTAAGCAACAACATGCAATTTCAGTCAAATACTACTTAAACTCCCTTTACATCAAGTAGCTCATACTAAATGCAACCAGAAAAAACAATATTTTCTTAATTAACAGTCAAAAGGCAAACATCATTTTCAGTTGATTCTGGTTCTTTTCTTGGAGGCCAAACCTCCCTATTTTCAAGCATACTAACTAACAACCAAACAAAATCAAACTAGCTTACATAAAATAGCTACAATAACAACACTAGCAATAATTTATTTAAGAGTTCGTTAAATTTATTTAATAGTGTTAACTCCTCACCTTTAGCAACCATTTAAGAGTAAAAAGAAAAAACAGAAATGAGTTTAGAAAGAAACTCAAATGAAAAAAATACATCTACTTAAAGAACAGTACATTAAAAAGATAATGAATAAAACAATAACAACAACAACAACAACAATAATAATAATAATGGATGCATCAGTTCTTCATCTTCAATTTGCTCAAATTCAACTTACTCTAGTAACAAATTCATGAATGATTAGCAATTAAATAACAAAGGAACAAAATTTTCTTCATAGTTTAATTTTTTTATCTTAGTGACTAAATTGGTTAAATAAGGATTTTAATTCAAAAAAGATTGCATAATTAGCTTCAGAAATAACTTAACAATCGAAGTTAAACTCAAATATGGTTAATAAATATTTGAAATAACTTAAGAAGCTAACAAGAAAACTCCTTTGTCTACAAATCTTGAATGTGATTAAACTGCTAACATTAAAAATGATAAAATAATAAAAGAAAATAAAGAATTATCTTAGTAGCAATTAACCTAAGAATTAATAAAAAGCGGATATAATTTACCTAATTAAAATCAATAGAATTTATCAAGAAAACAAATACATCTCTAATCTCAATGGGCAAAATAAAATCTTGGATTGGATAAATTACAACCAACATAGCTAATCATGGCAGATTAGAAGCAAAAAATACAAGAAAATCTCATTTAAAGAAGCATGGAAATACAGTAAAAGCTTTCTAAGAACGAAGAGAATAAAAAACTAGATATGCTATTTGTTATTGACTTTGAATGTAATTAGCCAGGTTATGAAATCATAGAATTCCCTGTTCTTGTAATTGATTTAAAAAAAGAACGTATCATAGATACATTCCATACTTACGTTAAGCCTACTACTTTTCCTAAGATAAATCCTTATATCTCTAAAATAACGGGCATTCAACAAAAAGATGTTGCCAATGCTCCTTCGTTTGTTCAAGTTATTCAAAAGGTTGAAGCCTTTTTATAAAAATATAAAGACTATGAAGGGTGCATTTTGTATGATTGTGACAGTGATTGCAACTATATGAAAAGCGAATTTATCAATAAAAACTACATTCCAACCAGTGATGTCTTCTTTTCATATATAAATTTAAGAAATGTTTTCCCTCTGGAAATTAGTGGTGGAGTCATCAACAAGTCTCTTTCTCATGCATAACAAGTATTATAAATGGAATTCTAAGGATGCAAACATAAAGGAATAGATGATGCTCGTAACTAGGCTTTAGTGTGCATCGAGCTTGTTAAGAGAGGATACAGTTTCACATAATTTATGATCTAACCTTAATTTTTAAAACAAGATCCTAAATGCTGTGTGAAAAATAATTTATTTAATTTATATGAATACAACACAAAATTCCTCTTGATTAAACTTGATATGGCAGTATAAGAATAAGAAAAAAGTGATACTTAAGTTCCATAAAAAACTTAGCCTGCATGTATGCCAAATCAACCAAATAAATACTTGAAATTTACTTGCTTTTTAACAGAAAAAAACCCAGAGTTAAATTAAGTCTATAGAATTAAAGATAGTACTTTCTATTTTGATTTTATAACCTGCTAAGCTTCTGGATCAAGATGTGCAAATTTGGCTTTAAGCACTCACCCAAGAAATTTATATTATAGCTAATTGACTTATTATGGATTTGTAGGGTCTAGTACAAGCTCCAATACTAGCAGCATTTAAAACTTTTAAGCCCCTAGCAATGTTGGTAAACATTAAAATTATGGTAAATAGGAAAACCAAAAAGGTAACAAATAAATTGATGAACACACTAAACAAGTTGAAAAATCTTTTTACCATCACTTTTCAAATTATTTAAAAAAATACAACATCTAAAGAAATTAAACTGCTTTTGTCTTACTTGGCTTTGATAAAAATGAATTCTCTAACTTTTAGAAAGTGTTCAATTTATAACAATATGAAAAAGAGCTTTTCTATAACGAAAAAATTATATATATTGATGACAGTTTGATTTAGTTTACAGGTTTTTTAGATGTTTATAAGTAAAAAGATCATTATAGCTAAAGAAAAAATTCAGCATGTTCAACTCCATATAAAAGAAAGAGATCTATGAGTGATGATCTACTTTCTTCATAGATTAAAGTAAATTTAAATCATCATGTGCAGTTTTAGGATAATATGACAAGTTAAAACTCTACAACTATTCCATAAAGAAAGAATAGTACCAAATTAACTAACTAATCGCCTATGATTAAGCCAGCTAGCACTACTCTTCTAACAGACCACCTCAACTTAAACGGAAAAGAAGAATACACAATTATACACAAAGGAGATCTATAAATAAATGAGAATGAGAAAAATATTTCTAAATCTCAAAGAAAAAGAAGTGGAAAGGACTTTGTAAATATTCCAGAACCTAAAACTATTCAAAATAAAATAGAGAAATAATAATAATAATTATAATAACCTCAATCCTAATTAAATTAAATAAATATGTAATAAACTATCACAGAATCTTAGAATGCACCGAACTAACAACAATAAAACTAAAATAACCTCTCAAATGCTTAAAATTAGAGCACAACTAGTAGTTTTAGTAAAGACCAGGTTTGCCAATTAATCAGAAACGATGAATTTAGTATTAATTTTGTGAATTTTATTTTAGTTAATAGAAAAAAGCTTTAAGAATATTAAGATTTAGCATACCATTGGTAATATATAAATAACAAGCCAAAATGA