TTHERM_00044970

Length: 828 bp

cDNA Sequence

AAAAGCAAAAAATTCAGTAAATTAAGAAACAGAAATATTTAATTTTAGAAAGAAATGTTTGTTGGATCAAACGTTGATTAATTAAAAGTTAGGCCTGGACTCACTAACATAAATATGGAAGTTAACCAGCCTTTATCTGTTACTAAGACTTAAATTATAAGATCAAACGAAAATTAATAGTTAAATAATGCAGAAATATTGGCTTAGCAAGAAATGTAGAAATCCATGCTTAGAGAATCCAAGAAGTAAGAGAAGTTAGATAAATTTTAAAAAACAATAGTTGAAAGAGCCGCAATTATCGAGAAAGAAAATAAACTTAAAAAGCAAGAAGATGATAGATTGAAGGAAGAGAAAAAATAATTTTTGTTATCTAGAAATAAAAAATCTTTTGGTTAAGAAGAAGGCTCTATATTTTCAGTTCCTGAACAAAGAGAGCAAACTTTTGCTAAGAAAAAGGAAGCATAAACCACAAAACCCAAAGCTGAAGAAGATAAGAAAAAAAAAGAGCCAAATATGAAGCTTTCAGTAGTTTTTAAGGCAAATGAAGAAGTATAGCCTTCTGATCCTAGAAACAAAAGCTAATCTCCTAAATCAGCTAAGAAATCAGAAGTTAAAACTTCTAGTGGATATAATCCTTAAAAGAAAAATAAAAAATAAAATACTCATGCTTAAATGATAATTCCAGTAGTGAGAGAAGACTAAGAAAGCGAAAGTGAAGATGAAATAGATTACGATATATGCAATTTTACTGATGCTGAGGAGGCTGTCACTAAATACTAAAACATTAGACAACATTTATATTCATTGACTTGCAATAAAAAATATTGA