TTHERM_00044980

Length: 591 bp

cDNA Sequence

ATGACAGAATAAGTAGAAGAAAAAAATTTAAGACCTGCTCGCATATATAATTTTATTAAGCAAGATTACATAGATATGAGAGAATTGCCTAATGTTAAGGTTTCTTCAGGATCTTATAGTATTTCTACAGAAGATAAAAAATTAGCAATTAAGTCTATAATTATGAGAAAAAAGAGGCAAAGAGGCTACGACAGAATTCTTTTCTAGACATAAAATACAGTAAGATCAAAGGAAGAAGAAGCAGAGTTAAAGAAAGACAGACATAGTTTTATTAATTACCTTAAAAGAAAATACAAGACATAGATTCCTGAAGAGTTACTAGATAAATCAAAATAAATTTAAAAGTAGCATTCAAGAGGATGGACAATCTCTGATATAATTTAATATGTTGAATAAAAAAATTCTAAAAAAGCCATAAAAAAAGAATTAAAGAAGGAAGAAAAGACTAAGGACAAAAAGAAAAAAGAAAAGCAAGAATAAGAAGAATAGGAAAAAGATAATTTCAATGAAGATGAGTCTTTTGAGGAGTTAGCTAACATTGATGATGATAATATAAATGATGAAAGTGGTGGTGGAGACTATGATGACTGA