TTHERM_00046120

Length: 255 bp

cDNA Sequence

ATGAGTGACAACGAAGAAAAAAAGGAAGTTAAGCCCATAAAAGGTGACGATGGCAGTTTATACTTTGAGCTTGATGACAAAAAAAGAGTTACTGTAAGAAAATTTAAAGGTAAATTATATGTTGACATCAGAGAGTTTTATGAAAAAGATGGTGAAATGCTTCCTGGAAAAAAAGGTATTTCCTTAAATTTATAAAATTGGGAACAATTCAGAAGCTTAATTGACAGTATTGATTAATGCATAACTGATATTTGA