TTHERM_00046990

Length: 663 bp

cDNA Sequence

ATGTCAAGTTTAAACTAGAGTATTGTCAATTAAGATATTCATAATACATCAAATGATGCTGATTTGAAAAAGAACAGAAGTATGCGCTTAATGCAGAGATTAGAAAAAAAATATTCTGAGCAAGGAGACCAAAAAACCTTACTTGAAAATAATGAGAACCTAGAAACAAGTTCTATTTAGACAAATCAATCTCAAGAACCTGCTATAAAAATCACTTCAAATGAATTCAAATAGAATAAGCCATAATAAACAGAGAATCAAGGTATATCAGGCAGCGAAAAGTTGGAATTGATGAAAAAGAAAGATCAAATAATAGAGAAATATGATAGACTTAGCATTATCATTTGTGCAGTTCTTGGGGTTATTTTGGCAATACTTTCAAAGTAGAGTATGTCAGTGAATTTTTTATTGATATTTGTTAGTTATCAATTATTGTATTAGATTATTCAAAGGAATTTTCTCTTGGCACGTATAAACTCATTATTAAATTAAGGCTAAACCGAATTGAATATTGGTAGTTTTGTCAGTGAAAAAGCTAATAAAGCCATTAATTTAATTTCTCATGTTTCTAGATTCAGTAAAGTTTTTAGGTAGTTGGCTGATGATATTTCTGCATTCTTGTTTACTTTTGTTGTCTTTTCTTAAATACTATAGCGTTTCTGA