TTHERM_00047080

Length: 1911 bp

cDNA Sequence

ATGTTTAAATACTTATCTAAGATATAAAGAGTTACCTTACACAGCAAAGTTTCAAAGAATTTTGCAGTTTTGTCAAAGGATCATCCCGAAAAGGGACCTTCCCAAGGTCATTTGACTGACAAATACACTGTCATTGATCACACCTATGATGCTATCGTTGTTGGTGCTGGTGGTGCTGGTTTAAGAGCTGCTTTTGGTTTGGTTGAAGAAGGTTTCAAGACCGCTTGTATTACTAAGCTTTTCCCTACTCGTTCTCACACAGTCGCTGCTTAAGGTGGTATTAACGCTGCTTTAGGTAATATGACAGAAGATGACTGGAAATGGCATTTTTATGATACAGTTAAGGGTTCTGATTGGTTAGGTGATTAAGATGCTATCTAATATATGACTAGAGAAGCTCCCGCTGCCGTCTTAGAATTAGAATCTTACGGTCTTCCCTTCTCTCGTACTCCTGAAGGCAAGATCTATCAAAGAGCCTTCGGTGGTCAATCCCTCAAGTTCGGCAAGGGTGGTTAGGCAAGAAGAACTGCTTGTGCAGCTGATAGAACTGGACATGCTATGTTACATACTTTATTCGGAAGATCCTTAGCTTATAATTGCAATTTCTTTATTGAATATTTCGTTATTGACTTAATTATGGATGAAGAAGGTGCCTGCAGAGGTGTCATCTGTATGTCTATGGCTGATGGTTCTATTCACAGAATCAGAGCCCATTACACTGTATTGGCTGCTGGTGGTTACGGTAGATCTTATCTTTCTTGCACTGCTGCTCACACCTGCACTGGTGATGGTATGGCTCTTGCTACTAGAGCTGGACTTCCTCTTGAAGATCCTGAATTCGTTTAATTCCATCCTACTGGTATCTACGGTTCTGGTTGTTTGATGACCGAAGGTTGCAGAGGTGAAGGTGGTATCCTTGTTAACAGTAATGGTGAAGCTTTCATGGAAAAATATGCTCCCACTGCTAAGGATCTTGCTTCCAGAGATGTCGTCTCTAGAGCTATGACTATTGAAATCCTTGAAGGTAGAGGTGTTGGCCCTAAGAAGGATCACATTTTCTTATAATTACATCACTTGAGTCCTGAAACTTTACATTAGAGATTACCTGGTATTTCTGAAACTGCCAGAATTTTCGCAGGTGTTGATGTTACCAAAGAACCAGCTCCTGTCGTTCCTACCGTTCACTACAATATGGGTGGTGTTCCCACTAACTGGAAGACTGAAGTTATTACCCAAGACAAGAATGGAAAGGACAAGATTGTTCCTGGTTTGCTTGCTGCTGGTGAAAACGCTTGTGCTTCTGTCCACGGTGCTAACAGACTTGGTGCTAACTCTCTTTTAGATATTGTCGTTTTCGGTAGAGCTGCTGCCAAACTTGTTAAGGAAAAGCTTAAACCTGGTACTCCTCATAAGGATTTACCCAAGAATGCTGGTGAATAAGCTTTAGCCAGATTAGATAAATACAGATTTGCTAATGGTGAATACACTACTCACCACGTTAGAACTGCTATGTAAGAAACCATGTAACGTCACGCAGCTGTCTTCAGAATTGAAAAGCTTATGGCTGAAGGTGTTCAAAAATTAGATCACATTTATGAATAATCAAAGAGCCTTAAAACCTTCGACAGAGGTCTTGTTTGGAACACTGATCTCATTGAAACCTTAGAATTAGAAAACCTTCTTTTATGCTCTAAATAAACTCTTCTCGCTGGTTTACTCAGAAAGGAATCCAGAGGTGCTCACGCCAGAGACGATTTTAAGGAAAGAGATGATAAGAATTGGATGAAGCACAGTCTCACTTGGATTAAAGATGTAAATACTGGTAAAACTGAAGTAACCTATAGAGATGTCATCAACCACACTCTTGATAGTGAAGTTACTCCTGTTCCTCCCGCTAAAAGATCATATTGA