TTHERM_00047230

Length: 1047 bp

cDNA Sequence

ATGAGATACTTAAAGATAGAGAAGGAAAAATTAGTTTCATGCAAGAAACAAGAATAAGAAGTTCAAAGAATAAGAAGAAGAAAAGGAAATTAAAAATTAAATAGTATTGCCAAACAATAAAGAGTAAAAAGAAGAGATTATTAATAAAATATAAAGCAAAACAAAGAAGTTAAAAATCCAAAAAAATTAATAAAATAATAAATAATTAATAAGGTTAAGAAAAGGAAGAAAATGTTTAGAGGTTTAACTAAATTCAACAAAGTTTTTGCTTTAAATTCCTTTAAAAATAGCTTAGTCGCCGTTCCAAAGGCTAACTTGAACCATGTTCAAAATATGTTAGAAGAAAATTTAAAGTATGATGCTTAAAAGTATAATGATGAAGTTGCTGTCATTCAAAAGACCTCCAGAATTTACAAGCCCACTTATACTATTGAGTTCAATCGTGAAGGTGAAGTTTTAGTTTACTCTGCTGATCCTATTAAGAACTCCGTAGTTTACTTCAAGTATCCTTATGTCTTATACGAAGCTGCTATTCCCCTCTTCATTTGGGCTTGGATCTACAATCCTTTGGAACTTAGCAAGAATGCAGTCAATAGTTTGCTCATCTACCCCAACATCGCTTGGATTCCCAGAATGTGGTACTGGAGATCTCTTCAATATAAGATCTAAAAAATGTACCTCCTTAGAGGTGGCAAGGTTGCTAAGATTGAAACCCAATCTTTGGCTGGTGATAGATTCACTTCTTGGGTTGAAACTTACTAATTCCATCCCTTGACTTAAGATCAAAAGAACTTCGATAACTAAGATAATGCTGAATTCTTAGAAGATGAAGGTCAATTAAAATACGAATTAGGTGTCCAACTTGATAACTTATAAGAAATGGGTACCACTTCTCAAGATATTGTTATTAACTTCATGAAGGAAGGTACTGTTCACCACCCTGAATTATTTGAAGCTATTGTTAAGGGTTACAATATTGATACTTCTGACTACGTCATTAATACTGCTAATAACCTCAGAGCCAGAGAAGGTAACCACAACCATTGA