TTHERM_00052130

Length: 888 bp

cDNA Sequence

ATGCTAAACAGGGTCTTAAGAAAGTTCTTCTCATCTGGTGTGGAGAGATAATGCACAATTTCATATCTTGATGGTAAAAACTAAGGAGTTGCATTAGTTGAACTCAATAACCCTTCCAAGAGAAATGCATTATCAAATAAGCTTGTTGCTGATGTATTTATTGATTTTCTTTTGATAAATTTAAAGGAAATTATCCATGAATTAAATTCAAACTCCAATATTAGAGTTGGTATTTTGAGAAGCAAAACACCTGGAATGTTCTGTGCAGGTGCAGACTTAAAAGAAAGACTCGGTTTATCAAACTTCTAAACTGAACTTTTGGTTGAAAATTTAAGAAACACTTTTGATGCATTATACCGCGTTCCCGTTCCTATGATAGCTGCTATTGATGGTCCTGCTCTTGGAGGTGGTTTAGAAATGGCTATATCATGTGATATTAGAATTGCAACAAAGAAGAGTTTACTTGGCTTACCTGAAACTGCCTTAGCTATAATTCCAGGAGCTGGTGGTACTTAAAAATTACCAAGATTAATTGGAGTAGCAAAAGCTAAAGAACTTATTTTTACTGCTGCTAAATTATCACCTTAAGAGGCTTTAGAATTAGGAATCTTGAATTATGTAGAAGAAGATTATGATTCTGCTTATAACAAAGCTTTAACAATTGCTGAGTTAATTCTTAAAAACTAAAGCATAAATAACATTTAACAATAGGGTCCTATTGGAGTACGTGCTGCAAAGGCTGCTATTAATTTAGGAAGTGAAGTTGATTTAAAAACAGGTTTAGAAATTGAAAAAATGCAGTACACAAAAGTAGCAAACAGTGAAGATAGAATTGAAGGTCTTAAGGCTTTCGCTGAAAAGAGATCTCCTGTTTACAAAGGAATTTGA