TTHERM_00059500

Length: 180 bp

cDNA Sequence

ATGGAATAAGTTTTTAAATCTCCAATTATTACTTCAAAGACTGATTTTGACAATGAACCGAACGTACCTTAAACCGAAGAAGACACACAGACACCTATTTTTCTTTATAAAAATACTCTCTTCTCTGAATAAAATAAAATTTTAAGCAGCAACATTTTAGCATCAGCAAATTATCCTTGA