TTHERM_00067000

Length: 444 bp

cDNA Sequence

ATGTCAGCTTAAAAAAAGCATTTATTATCAAAGCTTAGAGGACAATCTATTCTGGTTATTGACACCTAAAAAGATACCTATTCACATTTAAGTGAATTGTTTGAACCCTCTGTGAAGGTTTTGTTTTCTGACGATTAGAATGATTCTATATCCATAATATAAGACAAAAAGCCAAATTTAGTTTTCATAAATTGTGACTCCTCAATAGGCGCACACACTCGTTTTGATGGCTACGAGATAAGCCAAGCTATAAAATAGCTTGAGGCTTTTTCTCTCATACCTTCTATTCCAGTAATTCTTTATGCTAAGGTTAATTCTATTCTTAACAAAGAGAAATTTAGGATGAGTTCTGCAGATTCTCTAATTATATCTCCATTTAATGAACAAATAATCATAGAAAATTTATCTCAATTACCTATGTATAAATTCTTGATAGAGCAATGA