TTHERM_00069400

Length: 3474 bp

cDNA Sequence

ATGAGTAATCTAGGTAAAGGAAATGCAAACGATTTTTAAAATAACCCAAACTTCAACAACTTGAAGTCAATAAGAGAACAAATTCTTCATAGTGATTTAAATTTAAGCGATTTAGGTGATTAAAGCTATTAGTGTGTTCATCATGGAAAGAGAGAGTATTTTCATGAGAATGGAACTATTAAGTAAGAAATAACTGCATTTGATCCTAAATCTATAATAAATTACTATTGTGAAGACTGTAGAGAATTTTGTTGTGAATATTGTATCGCACTAGGCCCTCATAATAATGAATTACACAAGGTAAGCTTTTTAAAAAGCTTTGCTGAAAGATACTACGATTTCATAGATAAATTTTTAAGATCATCAGCTAATTAGAAGTGTTCACAACTGTTTAACAAAATAAAACAAATGAATGAGAGATAAGATTTGATATCTAATTAAGCACAAGTTATAGAAAGAGATGCATACATTGAATTTACTCATATACTCGAAAGACTCAATTTAGCAGAAGGCAATAAAGTTTCTGTATTGTAAAATGATATAGCTAGAATACAAAGAGACATAAATTCTATTGAAGACACAGTTAAGGCTTTTGAAAATTTAGCATCAAGAGAAGATAGACTTCCTTTCTTATTATTCTATAGATCTTTAAATTAGCATGTTATTGAGGCTTTATCTTTGCATGTTAAATATTAATTTTTATAGAGTAATAATAATTTTTTTATTTAAAAAAATCACTTAGAGGAAATCACACAAACACCTTATGATCTGCCTAGAGAAATCTCATCAATTAAAGTATAAATGGAAAATTTTAAACCAAACGACGAGATTCTAAAATTTAAAGATATCATTATTTGGGACTTAATAGAAGAAAAAAACAAACATTTAGAATCAATAAGAGTATAGTAATCAGAATCTTATCAATCTAAATTAGAATTATGGACAGAATTGGCAAAAAAAACATTTGAAGAATTTGAATCGATATAGCTTATATGCCACTATTGTGGTGAATTAATAAATGATGATATTATTAATTAGGATTGTTTTAATAACTAGATTTTTAAAGATCGTGATCGTTCAATTCCAATCACTGTATATTCTGATGAAGTAATGGAAAGAGGTATATATGGATCTAAGAGACATTTTTGGGTAAAGCCTCGTTTAAGAGATCGCTAGATTAAGCTTGGTTAACTCCCTAATATCTAAGCAGGAAAGAGAAAAGGAATAAACAGATCAGTAGCTTATTATAATTACATGAAACTTTATTAGTTGATGTTTGCACTTATAAAGAAGAAGAAGGCAGAAAAAGGAGTTGACTTAGAATAGATTTTTTAGGGATATGACAAAGAAAGATCAGGATATTGCTCAATTATACAGTTTTAATATGTTCTTAATACTGTCTTAGATCTAGAAATAGATTATGTAGAGAGGGCTACAGAATTTTTAGGAACTACTTAAAAAGAAGTAAACAGATTAAATGGTATTCCTGATGACGAGCCGTAAGAAGAAAAAAATTATGGAGAAAATCCATTTGCACCATCGTTTTTAATTAGAGAGCCTGTTCCTGAAAAACCAACATTAGTTAATTATATAGTGTTCTTAAAAATTATGTAAAATCCTGCATATTTAGAATACGAATCTTTTAAAGTAATTGACTACGCTCATATAAAATTGCATGGCTAGAATTACTTCATTTAATTAGATGATGATCTTTATAAGTAATGCAGATTAGATGGAAATACAAAAGTAAGCCAATAAAATGCAAAAGGGGATTTTAACTCTACCCTCAGAGGAGGATATAATGCAGGAAAATCCCAAGAAATTATTTTAAGAATTCGTCACCCAAAAGGTTTTAGCAGACTTACAGTTAACTCTAAGGATACTGTTAAAATATTAAAAGACAAAATTAGCGCCCTTGCATAATTGCCTGTTTCAGATTTTAAGATATTTTATGATTAAAATTATTCTTCAACTGCTTAGTTACTTTCACCTGATTCTACTTCTCTTAGTTTAATTCCTAAGTTGAAAAATGGTGTTGAATTGTTCCTCAAGGTACAAGCTTAAATGGCAAATCCAACTTTAGAGAAAAAAAGATCCCTAAGTCCTACACTAAAAGCTTAAAATTAATAAAACCTACTCTCAGTTAATTGTAATCACTCCCTCAATCAAAGATGTATTAACTGCCCTCCTTAAAATAACCCTAAAGAAAAAGAAAAAGATGTTAAAATACCTGCTTACGTAAATAAATGTACTCATCCTCCAGGTGGATCTTGTTTGAATTGCATAGACACTTCTAAGAAAGATGAAAAGCTTGAGAAGAAAGAAACTTAAAAATGGCTTTGCTAACATGGACCTAATGGAAAATGTTCTCACTGTATAGATGCAGATTACATTTCAAATATTAAGCACGTATCATTCACTCACTTCTTAGATGAGAAGAAACTTAAATGTAAAGGTGTTCATCCTCCCACTGCAAAATGTCCAAACTGTACTCCTCCTTCTGAACAAAGAATGACTGTTGAATTAAATTGTAAAAACCATGAACCATGGCCTAAGGCTATGTGCAATAATTGTCTTCCACCAAATGTTGTTGTTTATAGATAACCCTATAGACATGTAGATTTCGCTTAGTTTATGAATGTTAGAGAAGTTAGCAACTTTGTATAAGCATGGACATAAAATTCTCATGCAGAATAAAGAGTTGGATATATGTATGGTTATTATGCAGAAGACCCAAATTATAAGGGTGGTGTTAGAGCTATTATTGAAGCCATTTATGAACCTCCTTAGATAGGTGATATCTCTGGATTTTAGATTTTAGAAGATGAAAATGAGACTCTTGTTAACACAATAGCAGAAGCTCTTACTTTAGAAAAAATAGGATGGATTTTCACTACAATTAATCACGATACTTTCTTATCATCTCACGAAGTTCGTATGGCTGCTAGATTTTAAGAATAATATAGAGTACTTCATGAATCTGGCTATCCTTTCTCCACATTTATTACCACAGTTTTGAGAACTGGTAAGGATAACCCAAGTGAAATTAAACCTGAAGTATATATGGTTTCTGATTAAGCATAGGTTTTAGAAAAAAATAATGTATTTGGAGATAGCGAAAGAAGAAAGTTTATGAAAGTCAGAGAATCAAAAGATGAGAGAGATGTTTTGCCTTCTATTATCGTATCTGGTAAATAAGTAAATGAATTTGAACCTGATTTCTTATTAGTAAATGTTGCCCATGGTCATTCTAACCATAATAAATTCTCTATTGTTAAGCATGCTGATTTCCCTGTAGAAAACCGTTAAGAATAAAATAAATCATGGGAGAAATATTCTGATTTCCACTTATTAATCTACTTAGCTAAATTAGTGGATTTAGAAACTACTTTAGTAATTGCTGATGCTGTAGCTAAAGAAAAAGATGTTCCAGAAACCTGTGAAGAATTAATTAGAGGAATAGTTGGTTTTTGA