TTHERM_00070770

Length: 981 bp

cDNA Sequence

ATGAGTTTTACTACAAGTTTTTCTGACATTTTTGATAATCAAAAAGGTGTTTTGCAAACTGGTTATGTCCACAATAACTTTTCAACCTTCTCATTTACTAATTAAATATAGAATTAGTTTAAATTAAAGGCTAAGGTTTATTAGCGCATCGAAAACAATGGAACAACTTCTGTTCATAATAACGGTTTGCTTGAGCTTGATTATAAAAATGATGAGTGGAGATTTTCAAAAAAAATTGATGTAAATAGAAATATATCTATGAGAATTGATAAGCTCCTTTAACAAGAATTTGTGAAAGGACATACAATTTTTGGTAAATTTGATAAAGATTCTGACTCCTAAACTGAATCATAGCACAATCCCTGCATAGGTGTTTATAAAAATTTTGATAAATATGCATACAAGGCAAAATTTAATATAGAAACATTAGTTGCATAACTTAAGGGTAAAGCAGTCTATGATAAGCATAGCAGTGAAGATAAAGAGTAATATGGTACTGGAGTTTCAGCAAGCTTTGATTTCAAATAAAACTTATTTTCTAATGCCAAGACTTTAGTCTATTACAATAGCTTGAATACATCAATGAATATGCAATACTAAATGAAAAGATTATAAAGGGTCGATGACCATGAAGCTTCAAGCAGTTAAGGAGGAGAAATCTACTATACATTCTTGTATTCACTTTACTAAAAGTTAAATGATCATTTAAGTATTGCAGTTGAACTTAATCATGATTCTAATGAGAAAAAATTCGGAATGGTATTTGGTGGAAAATATACAAAATTTGATAATGTAATTTGCCGTGCTAAAATCGATGATAAATTTATCGTTAATTCCTCCTTCGAAATAGACATCAACAAAAATATTAAATTCACAATATCAAATATGATTGATTTGAGTCTAAGAAACAAAAAAGATGCAACAACTACTTCTTCTCATTATAGCTTCCCTATCGGTTTCTAACTTGATATCTAATAGTGA