TTHERM_00075810

Length: 1377 bp

cDNA Sequence

ATGGAAGGAGAATTTACAAAACTTAAAGCCGAATTAGTTGAAGGTGAGACATAAGAGCAAGCACCTCAATAAAATGGAAATGCAAACGCAAATGCAAATGCATCTCCAAGTGAAGGTAAAACTGAACCCACATAATCGCCCATAAAATAAAAAGTTAAATAGATAGCACCATAAATATAAAAAATTAAATACCCTGTTTGCTAGAAAGGCAATTTCCATGAAGGAGAGTTGCTCAACTACGTTTATTTAAACACAACAAATAAGGAAGACGTTTTAGGATGTGCTGTTTGCCAAGAAGAAAATAAAAAAGGTTAATGGAAACCCTTGAAGGTGTTGCTCCATCAAGCTTTGGAAAATTCAGCTAAACAAGCAAAGTCTGAATTCAATTGTGATGAACTTCTAATTTATCTAGATGAATAATAAAAACTAGCAGAAAAAGAACTCAATTAAATATATGAATCATTCAATGAAAAAATTCTTTCAATTAAAACTTCTATTCTTAGCTTTTTCGATAAAATGAAGGATTAAGTGCTTTCTCATACATCAGCCACAACTGAAATTAACAACCTCTTCGACAATGTATATGAGTTTAATGGAGATGTAGACAAACTTAAAAGTTCCGTTTCAAGGCTTGTTAATTTCATTCCTCAAGAAGACGATGAAGAAGGAGAAGCTGAATTGGAATAAAAAACTATCAAGATTAACATAGAAAATCAATATTAGGAAATATAAAGAACATTAGAAAAAGGTAATAAGGAAATAGAAACTTTATTAGAAACTCAGAAAAAGAGTCTGTCAGAACAGATTCTTTAAGCAAACATAATTTATAAGAATAACATTAAGTTCTGGTTTTCTAATACATATAAGCATGCACAAATTACTCTTGTTTCCAAGAATATTGTTAAATCAAATGGCTCAAATCCTAGCTATAGATTTGCAATTATGGAACCTGCCTTGCCTAAAAATAAGTAATGCAAATTTGCCTTTAAAATTAAGCAAGGATCTACTAACAACTGGCTAGCAGTCGGTATTTGTCACAAGAACACAATAGTCTCCAAGAATTATGGTTTCCAATTTTCAAATCTAGGACATGGTGCTTATATGATTAGCTCAAACGCAGGTACTTGGTCAACTAGCTAAAGTGCATTCAACAATGTAGTTAAGGCATTTAGCTTTGCAAAAAATGATGTAGTAATTGTTGATTATGATCCAATCGGTAAAACAGTAAAATTCTCTAAAGAGAAAAAACCTGACTCAACTTACAAACTTGATATAACTCACATTGATAACGATCCTCTTCATGCTTGTGTCTTATTTTATTATGTGAATGATGAAATAGAATTTATTCAAAATTATAGACCCAATGCAGCCAATTGA