TTHERM_00079260

Length: 633 bp

cDNA Sequence

ATGGAATAAGAAATAGATGTAGATGTAAGCTCTCAATCATAAGAGCAACAAGAAGAGAAAGAACCTTTTGAAGATTTAATTTAAGAATGCGATGAAAACGCTAGAAAATTAGAGATACTGTATATTTAAAAGGAAAATGAATACCAAGAACTTTGTAAAACTTTGAGTGATTTATAGGATCAAATATGGAATCATTAAAAAGAAGAATATGAGCAGAATTCGATTAACACTGATTAGTAAATTAAGAAAGAAATAGAATAATTATCAAGATTGCTTGCTGAGAAAGAAGAAAAAATTGAAACCTATGAAAAAGAAATTAGTAACAAGATGGATGACGACTAATTAGTAAGAATGAGATCTAAGTATAAAGAAATTTAATAGCATAAAGAAATCAATTTAAGAAAACAATATAAAACTGCTATCAGTGGAGAATAAGAGTAATATCCAGCTCTTAGGCAATATGCTGAAGAGTTAAAGCATGAGCTAGATGTTAAAAAGGCAATAAAAGAAAAATTAGATGAAGAAATAAAGAAATCAGATGAATCTATTAAAGAGCTTAGAAGGATGAAAAGAGATGGAGCTTCTCAAGAACACGAACTGTAAGAAGAGATAGAAAATTTAACTTAGAGATGA