TTHERM_00082150

Length: 363 bp

cDNA Sequence

ATGTTAAAAGGAATCTTCGAAGCTCTTGCAGGCAACTTAGTTATAATTTGGGTTATGTTTATTTTATGCCCAGTTTATCTTGTTTTAGGAAATTTAATCGCAAATTTCTATAAAAATATCTGGTTAATGGTAACTAGTAGATAGTCATGGGTTTATAAAAATTTAGGAGATCTTTCATGGCTCTTCCCCTTCACTTAAAGTAGCTAACAAATTAGATTAACTGATACTCTCTTAATTTCAGTTTTATGTGGTATTTTATCTCTTCTGATTGTAGTTGCTATGGTTTATAATAATATGCAAGAAAAAAACCAAAAAAGACTTGAAAAAGAAATCAAAGAAGAAATGGATAAAAAGAAAAATTGA