TTHERM_00083650

Length: 507 bp

cDNA Sequence

ATGAATGGAAAGAAGCTTAAACTGTCTATTTGGGATACAGCTGGTTAGGAAAAATGGAGAACTATTACTACAAATTATTACAAAGGATCTGATGGTATTGTTGTAGCATATTCAGTAGAAGATTAAGAATCTTTTGACAAAGTAGGAAGCTGGATTGAAAGTATAAAAGAAAATTGCGATAATGTTAATATATCTATTTTATTAGTTGGAAATAAATCAGATTCAAAACAAAGAGTAGTTACATATGAATAGGGTAAAAAGCTTGCTGAGTAATATAATATTCCTTTTTAGGAAACTAGTGCTCTTGATAATATTAATGTGACCGAATCTTTTAATTAACTTGCTAAAATGTGCTTAGATTAGCATGAAATAATAAGCTCTAAAAAAAAGAACCAGAAATCTTCATCAAACGATATTGATGAGCAAATAACTGGCCCTTCTTAATCTAAAAAGTTAACTTCAAAGAAAAAAGATGAAAACGGAGAAAGTAAAAAAAATTGTTGTTGA