TTHERM_00086830

Length: 1227 bp

cDNA Sequence

ATGAGTTTTATTAGTAGAGCTTTCAACAAGGGATCAAAGCTAGCTTTAGCACATTTGATGAAATAAAGAAATATTGTTTTTCCAGTATGTTTTAATTTCAGTCAACTATAGAGCAAAAATTTTGTTATGAAAAAAACAGAATTAAGCAATGATTTACTGATTTCTTTATCAATGGGATTTGAACACAAAGAAGCTACTAACCAAAAAGAGTTAACATAGAATTTGATTATTAATAATGTCTTAAAGGATAAAGTTGTATAAGATGTATTTAATGAGCTAGATAGAGATTTATTTGCTATCAACAAGAGCTAAAAGATTTATGCTAACAATCCATTATCGATAGGAAAAGGTCAAAACATGACTTCGCCTTTAATGCACGCTATTGCTTTGTAAGAGATATATGAGAGATTAATGATCTTATTAAAGTAAAAAAAAGGTTCTGAAATAAAAATTTTAGATATTGGTTGCGGAAGAGGATACATTGCATTTGCCATTTCAAAGATTATTGAAAAATGTGATGATTTAAAAGATATTAAAGTATTTGTAAAAGGTATTGATATTTACGAAGATTTAACATATGGTGCAAATGAGATTCTTCATAAATTAAATATCAACAAAAATATTACCTTCCAATTTGATACTTTAAATATCGAATAGGAAATACAAAACAAATAGTAAGTTTATGATATTATACATTCAGGAGTTGCTCTAGAATTAAGCGTTTACAATAATATGATAGGCTAAATTTATGCTTAAAATCAAGAAGGTTCTTGTATTATTTGTCCTGTCATTTAAGAAGATTTAGAGTAGAATTTATATTTGAGATGCAATAACTAGGAACATGTTGTTATGAAATGTGTTTATTCTTAAATGATTACACTTAAATAGTAGGAAATAAGCAAATATTTTTTGGAAGATGGAGAAATTGCTGAAGAAGATTCAACTTCTACTTTATAAGCTTAATCTCAGTAAAGCTAAGAAGAAATGAATCTAGAGTTATTAGAAAATACTAAATTAAAAAGAGAATAGCATAAAGTTGAGCAACAATTATCATAAAAAGAGGCACAGTTGAAGCAATATTTCGAAAATTTCAAAAAAAATAATAATGGCATTGCTCCTAATTTAAAAGAAATGAATAGTAACGAAGAAACAAAGTAATTACTCAATGAAATATCACATCTTAAAAAACAATTAAAAATAGTAAAAGCTAAGTAATAGATAAAATGA