TTHERM_00088150

Length: 5310 bp

cDNA Sequence

ATGAGCAATGTCAACTATAAGAGACCATTTTAGAAAATGAGTGTTCTCATAGAAAATGCTAGCTCTGAGAAAACATAAAGCAAAGCTTAAGATTAAGATATCTAAATTATAAATGAACCAGAAAAAATCAAAAAGATTAAGCTTATTTCTGATATAACAAAAGAGTATAGCAAAATAAACCCATCTTCTGTGCAACTTAGTGAAAAAAGAAATGAAAAAAATTAAGAAAAGAGGAATTCTTTTTAAATAAACGATGTTCCTAAAAATACTCTCTTCCTAAATAGTGGGAATAGGCAAGATAAATTTGGAGAAGGATAAGAGGATTTTATGAAATTTGATGAGGAGATTTAGATTAGTAACACTATAGTTAAAGAAGAGATAGTAGTTGAAGAGGATTAAAATAATAGCAATAATAGAAATAAGAAAAAAGTATTTTACGAATTTAATGAGCCGATTAGTCCTGAACAAGAAGAGCTTCCAGTACATGAAAATAGGCTATCAATTTTAGAGACAATTAAAAATAACAGCGTGATTGTAATTTCTGGAAATACAGGTTGTGGCAAAAGTACTTAAATCCCTAAATTTATTGCTTGTGATGATACTTCTACTAAAATTATTGTAACTTAGCCAAGAAGAGTAGCTGCAATAGCTTTGGCAGAAAGAGTATCATAAGAGTTAAAATCAAATCTTGGACAAAGAGTAGGCTATTAAATAGGATAAGACTCTAACTTTAATAGAAATACATAAATACTCTATGTTACGATAGGTATATTTTTATAGAAGTTAATTAATGATCCTGATTAATTTCTGAGAGAGTACACTCACATAATTCTAGATGAAGTCCACGAAAGAGGTATTGAGTCTGATTTTGGTTTAATTGCACTGAAGACGTTTTTATCTCAGCATAAGAATAGAAATTCTATCAAGCTTATTGTAATGAGTGCTACACTGAATAAAGATATTTTTTTAAATTACTTTTCAACTACAGAACTTAATAATCTTGAAAAGGAAATAAAGGAAGATTAGGATTGTCAAGAATATTATTTTGATAGCTCGAAGTTTTCTGAATAGCTAAAAATTACTAAACAAAATGACGATTACAGTAATTGGGGACAGCAGAAAGCTCATCAAACTTGGAATGATCAAGATGACCATGATGATACATATGAAAAAATGCAAAAAATGATTTGCAGATTTAATTGCAAATATGAGTCAAATTAAAAAAATTATGTTGAGATCCAAGTAGTTTAAAAATACAAAATTTAGACAGTATGGTTAGAGGATTTAAAAGATACTTAAAAGTTATGCAACAAGAATTATTTTAATGCTCGTAAACCTGAATTGAATGAAGATCTTTATAAAATAGTTGCTAAAGAAATAAAAAGAGTGCAATTTTAGGAAGAACCTATGCTGAGATCATATAAGAAAGGTGACATTCTTGTATTTCTTCCAGGTTACAACGAAATCGTCAAGCTTCATTCAATCTTAGATTAAATAATGATGGAATTCAAACAAACCAATTAGAGTATTTATAATTAAAATAAATATAAAATCATAGAGTTGCACTCCTGTTTGGGAGACATCAATACTAAAGAACTTTTTGGGAGAAATTAAGATTACACAAAAATTATTCTAGCCACAAATATTGCAGAATCTTCTATTACTATCCCAAACTGCTTTGTAGTGTTTGACTTTTGCTTGACTAAAGAAATAAATTATAATCCATCAAGTGGAATTGAAAAGCTTGAACTATAATGGGCTTCAAAGGCTTCAATTACACAAAGAGCAGGCAGAACTGGCAGAAACTGCAATGGTGTAAATATTAGACTAGTTCCTAAACAATTTTTTATGGCAGAAATAAAAGATTATTAAACACCAGAAATATTAAGATGCCCAATTGAAAAGGTTATTTTAAAAATAAAAATTCTAGATGAAGGAGAAAGTGACTACCAAAAGATTCATCTTAGTGATGATGACGATGTTGAATAAAATAATTTGATAGAAGAGATAATTAAAGAGAAGTAAAGCGAGAAGTCGAAAAAAAAGAGATTAAATTTTAGCACTGATTTTGATGATATAGATTATATGAAGTAATTTGATACAAAACCTGTTTTTGATGGGCAAGATACAGCTTTCCTTATAGCAGGACCTATTACTAAAAATAAATCTAAAAAGTAGTAATTAGAGAATTCATAAAATTTAAGATTGTTTGAAGACCCTGTGAGAGTTCTTTAAAGAGCAATAGAAGCACCTGATGATTATAGCATTTGCTAGTCTATGGAAAATTTGATGTCAGTAGGAGCTTTGAAACTAAAAAAAATACAATACACTGATACATAAAAAGAAAAAATAAAAGTAAAAGTTACTAAACTTGGTAGATTTTATAATGACATGCCTTGCGACCTGAAGCTTGCTAAATTCATATGCTTTGGGTACTTTTTCGATTGTCTTATAGAATGTATCACTATTGCCAGCATCTACAGCTAGAGAAAATCATTTTTTAATCCCTTTTACAAAATTAGTGGCAATTTAAAATAAATTGATTAATTCACTGATTTGATATTTAGATATGATCAAGGCTAAGAATCTGACATGATATTAGAACTTAAGATATTTTAAGAATGGGAAAATGAATTTTTTTAATCTTAGCTAGAGTTTATCAAGTTAAGGAAAGAGTCTAAAATGCAGAGCAGGTAAATTAGGCAAGAATCAGAATAAAATGATTTTCTTTCTTTGGATCAATCAATTCCTAAAATTTTGAGTGAAGAATAACTCAAATTACCTTTGTCTAAGCAATTAGAATTATTAAAAAATTCTTCCAACCATCCTTAAAATTAAGATAGTTCTATTGCACCCACTCTTTCTTTTTAATAATATTTACCAGATAGGAGCAGTGAAGAAAAACCACTAAAAGGAATAATAGATAGGTATTTTATAGAAGAATTTAAGAAGAAAAGAGCTTCTAGAGAAGAACTACAATGGTGTGAAAAGCATTTTTGTGATCCTAAGGTTTTGAGAGAAATTCTAAGTACGAGAGAAGACCTGAAATAGAGAATACCAAAAGAAGCAGGAAGCATGTACGATATTTTTGAATTCAAAGATTTAAATGATGATAGTCATTTGATGAAAATAAAGTTTTGTTTGGCTGGAGCTTTTAATAAATACACTTTAAAGTCAGACATATTTGATATAAAGGAAATGTAAAAAATCCGTTAGTACCTTTTAGTAGAGTAGATGGATCCATTTAGCACTATAATTATAGAAAATACAGTTTATGGATTTTAATCTCTCTCTATTAATGACAAAGATATTATAATTAAAAAAATAATAGATGGAGTCAACCATTTCATCAAAACAAAACAGCTATTTAAAGAGCTAGATGATCCATACGAAAATGTAGAAGCTTTAAATAACAACTTCGTTTCAAAAATTAAGCTTAAATATTCATCAGTCTACATAGAATTCAAAAAATTTTCAAAACTTCCTATCCTGTTAAAGCAAATTATGACTTTCAAAAAAAGATACTTCAATTTCATTAAACTATAAGACAAAGACACTAACATTAAAGAAATATCGGCTACAATTTTTTTAGATAAAAAAATTGACTTTGATTAAATCTTTATTAAGTAGTAAAATAATTTTAAATATGCTTATGAAGCAAAATTGAATATTTCAAATTAAAAACTTAATCGCCTTGTTTCTCTTGAGAGTGATTCTATAAATTTAGTTACACTAGGAGATTATAATAGGCATAAATACTTAGTCGCCTCAGAGTTAATGTGCAGAGGTCATAGGGTAGTTGCTTAAGGAATTACTGTTATGCCTCCAAACTTTCCTTTATTTTTGGCTTTTGCAGCTTTGATTTTTGGGTCATAATGTTATGTTAATTGTGATAAAGATGGCAAGAAATACGAAGGAGTTAATGTGGATAGCGTTGAAATAGAAATAGACCATTATATGCTTGATAATGATATTAAAGAAATAAATGATATTAGAAGAGAACTTAGGGCTTGCTTAGATGAAGATAGTTTTTTCAATGGATAAGCTAATCTGCAGCTAGATTTATGGAATAAAGTAAAAAGAAAATTACTTTCTAGAGTAATGATGAGACATGTTGATTCTGAGAAATGGGAAGACATATATAGCAAGGAATATCTAAATGGGACTTTTTCTGTAAATGTTGAAGAATAAAACAAATAAAAGGTGATGAAAATACTGAATAGTATCAGGACGACAAATAGTTCTGAAAATTGTAAAACAAGTGAATGTTAAAACGAAGAAATGGATTTAGAAAAAAATAACAATTCATTATCAATTGCATAACAAAATTAAAAAAAGAGAAATGTTAAGTTATTATTTTAGAATCATAAAAGAAAAAACAACTAAGAAAAAATAACTCATGCTTCTGAGAAAGGATTTATGAATTAAATTCTTCAAACTAAGAAGTAGGAATCGAATCTTGTAACTCTTTCTGAATAGGAAAATATCAATCTTTTATAGGAATACTTTGAGAATTACAATATTTGGAAGCAAATGAAAATGAGAGAACTCAAGAGATTTTTCCTTCTTCATACCATAGATGAGCCAATTATAACTTGCAAAGCTTGCTATCATTAACTGCTCTTTTAAGTGCCTTTGTTCAAAGCAAATAAATTGTAAGCCCAACTTGAAAAGTTTATGAAATTAAATTTTAATGGTTTTACAGATAATTTATATTTGAAGGACATTAAAATTGAATAGCTACTTCAAGAAGCAGAATTTAACCAAGATAAAACCAAATATAAAACTTAATAGGAAAAAGATTTAGAACAAAATGCAGATTTTATCAAAGAATTGAAATATAATTTTAATTAACTCAATTCATAAAACTCAGATCAAATTTATAGCTTCAAATATTATGCCTGTTAAAATGGCCATCTTATTGGATTTACTTAAGACGATAATTAGTTATATAATCAAATGCATATCCCAGATTGCAACCAGCTCCTAATTCTATATCCAGACCTTGAATATAAAGTATTTAGTGGGTATGAAGACTTTTAAGAGGTTAAGTTAACTGAAGATTAGTAAATTGAAATATAAGAACACAAAGCTTTAATGCTTCTTGAGCTAAATGAAATAAGTTGTATCATCTGTAATTGTGTCATGAATGACAGTGAAAAGAAAGATGAAGAAATCAAATTCTAAGATTAAAACGTAACTGACTGGAGATCAAAGCTTGAGAAGCATATGAAAACAGAAGCCCATAAGTTGAATGAAGAAATCTTTTTAAAATCAACAAGATCTCCAAATTACTTTTTCACAAATTGA