TTHERM_00101270

Length: 1722 bp

cDNA Sequence

ATGTATTAGAAAGTTGTTTAGAAATTAATTAATACATACATACATCTATACATATTCAGTCAGATAAAAGAAAAGTAATAAGGTAAAGAAAAAAACTAATAATAAATTAACAAGAAAAATTAGTAACACGAATTAATAATTTCAATAAGTAGCTCGAATAGTAAAGATCCTAGCACAGAATAGGCATTTAAATAACAAGTCAGATCATATAAATTTGGTAATATCATGAACAATCTCAAGCAAACTGATGAATTTATGACTGAGCAATAGCAAAATTAATTGGAAAATTCAATGAAGGACCTGCTTGAAAAGATACTCACTTATATGGAGAAATTTATCAAGACAAAAGATGATTTATAGGCAATCGAATCGAAACTGAATGATTACGATAACTTGAATTCTCTCTTGGACATTATAAAATCTATATTTTCCCATCTAACTGCTAAAATTGATGAGTACTTGCCAAAGGATAAAGCATAGTAAAAGACTACCAATGAAAACAATGAAGACTATGACTAGCTTGAAAAAATATTATAAAAGCATGAAGCCGAAATTAGAACTCATATAAGACTTGAATAGTAATTAAAGCTGTACGCAGAAAACTTACAATCAAAATTAGATGAAAGCGAGCAAGCACGTAGCGATTTACTCGAGTCAACAAAGGCTATGATCAATGACATAAAAAGGTAGAATAATGCTTTAAGTGAATAACTGTCAAAACTTTAGCAAGAAAACTAGGCTTTAACAGAATAAGTAAAGGGATTTAACGAAAACGAAAAATTATTAGAAGAAAAGCTATATAATATGCCATATTTGCAACAAAAAATCCAAACGCTAGAGAAATTAGTCAAGGACAATATGCAAGAAAAATATCTGACAGCTTCCATGTAAAATCTTCAAAAAGAAAATAGTTTTAAAAAGGTAATTGCTTAAAATGAGCAAGATCTAAAGAAAGTTAAAAAACCTGAAACACCTCCAATAAATTAAATGATGACAAATAGTGCTATTTAAGGCACTTCTCCTATTAAGGTAGAAAGACGTGCTCCAACTCCAAATCTGAATTCATAAGGAAAAGGTATTTTACAATTTTCTTTCATAACTACCAACACTAAACCTTTATTTTAAGTGTAATTTTGTAAAGCGAACTTTTAAGTTATTAAAGAAAATAGCATAAAGGCAAGTTACCAGAGATTCTACAACAACATTAAGATGAACAGAGAGGACTAGACGACATCATCAACCCTTGCTTTTTAAAATGATAAAAGTGAAAATAAAATAGAATAAAATCTTTAATTAAGCAAAATATTTATTTCTGAAATTTTGTTCGTTAGCTCGTTCGTTCGTCTAAAGACCTTAATTAGAAATAAATATTTTCAGTTGATTAGTAATATTAAATCAAGTTTTACTTATTAATAATAAAAATTTAATATAAATAGAATCAACCAATTAATTTAATCTTCTCTTCGTGAAAGAGACGCTAAGACCCTGAACAGTGGTGGAGGCAGTATTACCAACTCTCATAATAATTCAATAATATGCAATAATAGCAATTCAAGTAAAAATTTTAAACAAACAAACCACAAAAGATCTAAGAGTCACTAAGTTAATAAAATAAGAGGCATGGTAAATGGAAATATAGCCTTAAAAAACCCAACTGATTACTCACGCTTATCTAACCAAGACTTTTCTGATATTCAAATTACAACTGGCTACAACAAATGA