TTHERM_00105320

Length: 1209 bp

cDNA Sequence

ATGGTTTACTTTTTGGTTGGTGCTGAAAATCTTTTTGGTGATAGTGATAAAACCTTTTCAAGAATCACCACAGAATTAGGCAACTTGGCTACCATTAAGAATAGGATTGATGTTCAAATAAGGGATTTCAAGTTGAGCAATGTTGATTAGTTAATTTCTTCCAATGAAGCTATGCTTAAAATGGAAACACACATTGAAAGTATCTTGAAGAAAATCGAAAGAACATATATGGATATTACTGAATCTCAACACGCTGAATTCCAAGTTAATACTAGAAGTAGTTCTGTTTCCTTGAGTCAATATGTTCAAGATTTTAAGTGGGATAATAATATTTTCTCCAGAAGTTAACCTTTAATGGAATTGTTGAAGAGTTTCTAACAAAAAGCAACTACCATTGATAACGATATTCGTTAAAAGCAACAAGTTCTTTAAGAAGCCAAAAATAACTTGAACAGTGTCGCCCTCAAAGAAGGAAACTTATTGGTTAAGGATTTGAGTGATGTTTTTAGAAAAGAATATGTCAAGGAAAAGGATTTCATTTATACTGAAAATTTAACTACTGTAGTAGCTATTGTTCCCAACAATGTTTTAGAACACTTTTAATAACAATATGAATTGATGCACCACTGTGTTGTCCCTGGATCTGCCAAGTAATTTGAAGGCATTTAAGACAAAGACTATACCGTTTGGAGAATCGTTATATTTAAATTAGACTATAAGAATTTAAAGAAGATTTTATTAGAAGGCGAAAAGCTTGATGAAAATGGCAAGCGCCAAAAAACTCCTGTAGAAGAATTCATTTCTGCAAGCAGAGAAAAGCTAAAAGTCACTGTTAAGGAATTTTAATATAATGAAAACGACTGTGCTGAAAGAGAAAGACAAAGAACAGCCTTCTAGACTCAAGCTAATAGTTAAAGCGGAAAATTAAGACAAACTTGTGAAAAGAGTTTTGGTAATCTTTATGAAGTTTATATCCACCTTAAATTCCTTAGACTTGTTGTTGAAATAGCTGCCAAATTCGGTTAGAAATCTAACAATACTACTTGTTTGATTCAACCTGCTCCAGGAAAAGAAAAATAAGTCCAACAAAAGTTGTTAAAGCTTTTTGCAGACCGTGCTTAATTGGATGCTGGTATGTACGGTACTAAGGAAGAATTAGAAGATACTGAAGATTTCTTCCCTTATGCTTATGTTCCCATTACTGTCTGA