TTHERM_00106960

Length: 738 bp

cDNA Sequence

ATGAGCGGATCAGAAACCCAAATTACAGTTTTTTCACCTGAAGGAAGACTCTTCTAAGTAGAATATGCTTAAAGAGCTGTTAAAAACTCTGGTATCACTACTATTGGTGTCAGAGGTAAGGATTGTGTTGTTTTAATTACCGAAAAGAAGACCTAAGAAAGTTATGTAGATATGAATTCCTTCACTAATATTCACACCGTAAGCGAACGTGTTGGTGCTGCTACCACCGGTTATTACCCTGACTCTAAAGCCATTGTAACCAGACTTAGATAGGAAGCCAGTGAATATAAGCTTAAAAATGGTCACTTCATGCCTGTTGATTAGCTCTCTTGCAGATTAGGTGATTTATCCTAAGTTTATACTCAAAAGGCTTTCATGAGACCTTACGCTGTTGAAACTATTCTTGCTGGATATGACAACGAATTAGGTCCTTTACTTTATAAGAACGATCCTTCTGGTTACTTCTGTGGTTACAGAGCTGTTGCATCAGGTATTAAGGAACAAGATGCTATCCATTAATTAGAAAAGGAATTTAAAAAAGATAAGAACGCCACTTCCATGAGCTTTGATAAAACTATAGAAGTTGCCATCAATACTTTAAAAAATATTCTTAACCGTGAATTCAATCCTACTGATATTGAAATTGGTGTTGTAAGTAAAGAATAACCTAAATTCAAAAAGCTTAACGAATAAGAAATCGAAGAAGCTCTCAGAAGAACTAACCAATCAAAGTAATGA