TTHERM_00107160

Length: 411 bp

cDNA Sequence

ATGTAGAAAATAGCATTGTACCTATTTATTATTGCTACTATATTAAATATCTGTGTTACAGCTTAAAAAAGCGACTCAAATATTAATAGATTGCTGACACTTAAAAAGCCATAAGTTTTAAATCAAAATCAAGAATATTAGCTTAAAAAGCAGATTAATCACTCAAATCATATTAACTAATTTAAATAAGATGATATTCAATATGAGGAAGGAGATCCTTAGCCTGCTCCTGAACCATAACCAGAACCTTAACCCGATCCATAACCTAAGCCAGAAGGAAAACCCGATGAAGGTTCTCCTGATAATCCTAATCCTCCAACAAGTATTTGGGATAGGTTATGGTGGAGTTCTTAATAGAATTTAATGTATAAATATACAGGATTGATTATTATCTTACTTTGTATTATTTGA