TTHERM_00112450

Length: 1143 bp

cDNA Sequence

ATGGACAACAGCTTTTTTCCTAATAACTAAAATACCAACTAGTAGTATCAAGATAATTAATAATTGAATTAATAGGTCTACGGAAACAACAATAATAACATAGTCTATTATACAAGAGAAGAACTTCCTGAATATCAGGAAGGTACAAACCTCTAATAAGTTGGAGAAATTATCACAAATTTAATCAATTCCAAGTAAAATTGGCGTGATCAATTTGATGCAATTACTCACATGCGTGTGCTAAATAAGAATTATCCTTAGCATGTAAATCAAATCTTTTCTAACTTCGGAATGTAAATTTTAGAAAATATCGAAGGAGTTAAGACCTGTACTCTCAAGAACACTCTTCTATTCATTAATGAAGTATTTATGTCTTCATAAATAACTCCTTTAAATGATTTAGTCATTGAGAAATTTGCTCCTATTTTGCTTTAGAAGTCTATAGACGAGTCAAAAATTATTTCTTAGCCAGCATAAAATGCTCTTCTTACTTTTACTTAGACTTGCAGTCACTATGATTCAGCCTATGTTGTCATCATCAAAACAGCAGTTATACATAAAAATCCCAATGTCTAAGAAATAGCTTTGAAAATACTTTCTTAGCTAATCTTAGAAGCTAAAGAAAATTTAACTAAGCTCTAGCCTTAAACTTTTAGCTACATTATGAAAGGATTGACTCAAACTATATCAAACTCTCGTAGTTCTATTAAGGCTTTGTCTAAAGATGTAATGGAAACTATGGCACAAGTAATCGGAAATTAAAATTACATCAACATGATGTAAAATGTACTTTCATAAGAAGAATAGAAAACCATACGTGAAAACTATGAAGAACATGTTAACAAAATTAGTAAATCAAAGAGCAAAGATTTTGTTTAAAGTAATCGCAAATCTATGATATCTTAGTTTAAATCTTAATCTAAACAGAGTATGGCCCCAGTACTAAGAGGTGCAAATATTATTGAGATTAAAACTAACCAAGGCGAATAATATTAAGGAATCTTGCAATAGTAAGATATGAATGTAATGAACTAATAAAATAACATGAATTACTAAAATGGCAATAACAATTAATATTATCAGTAAAATAATAACAACAATAACAACAACTATTTCAATTAAAATCAAGGTTATTACTATTGA