TTHERM_00113330

Length: 2811 bp

cDNA Sequence

ATGAGTTCACTATTTGGAAATAAGAATAAAGAAGTCATATTCAACTTTTGTTAAAAAAGTTAGGAAGAAGATTAAGATATGTTTGCTGATCATGAAATATTGATAGATGAATAGTTATAATGCTTTAATTGCAACAAATATTTTGATCCTACAAAATATGGAATTGATTTGTTAGATGAAATGGATTTCAATAAGAATTTAGATACTTTTTGTTGTGAAAACTGCTATCTCAGTCTGCATTTTCCTTTTTATTATTAATTAGATTTGCTTTTGAAAATGAGTAATTTAGAAGTAAACACTAAGTATGAATTTAATCTAGTATTGCAAGAAGAGTGCTATTAAGACAGCTGTATTTTAGGAGTATTTTTGTCTAAATAGAATCTTATCAACGTATTTAAAAAATAAACAGGATCACATAATTTCATTCTCAATGTTAAAATGAATGGACAGGATCCTAGCTAAGAGGGAAGCAATTTTTTTGTTATTGATTCTGATGATTTGACATAAATGCAAAACACTTTAAACTTTGAGTGCTTAAATTTTTCTTTCTAAAAAAGTTTCATAAGCAACATTATTTTAATGAATGATTAATAAAAATCATAATTAAAGACTGCCTCACCGAATATAATATCAGTAATATTGCATTGTAGGAAAATAAGAGTTAGTGCTTATGTAGCTAAGCTATTCAAAAAGAAGTTCTTTAACTGTCTTAATCATGAAAGTCTCTTTAAAGTCTTCGAAGAATAAGAGTAAAAATATAAACAAAAAGATTAAATTCAAAAAATCAAATTATAAACTAAGTAAAATAGCTTAAGCACTAGTCAAATACATTAAAGCTCTACTTTAAATGAAATTTAGCCATCCTAACTTTAAACACATAAAGAAACATCAAACATTAGTCAGAGTTCATAATTAAATAAAGATTTTTGTGAAAAAAAAGAGCTTACTGAAATATATCTTAGAATTAAAAATTTTCATCAAATGTTTCCATTTATGTATAAAAATGAAATGGTTGTTAAAATGGATGATAATGCTGTGATTTAGTATCCAGCATTCACTTATCATCATTCTCATCCATTTGATTTGAGAGATTATTGCTATCTAAATTAAGTTAACCCTACTTGGCTGTGTCCTATTTGTAATAAGCACAAAATTTTTTTAAAAGAAATTTAGTTGGACTTCTATTTATTCGCTTTGATTTAAACTCAGTACCTTAAAGATTCATATATTTCAGATAAAATTTAATAAATATTACAAAGCAAACCATAATTTGATTCTGAATTCTTTAGCAATCAATTAAAATAACTAAATCTGCATAGCATGAAGGTATTAGAACAAACCCAATAGAGGACTTAGTCAAATGAAATAAAAATTTAGCAAAATTTATCAAATAAATTAAATTAAACAAATAAAAATTTCATCTAAATTTATAAAAAAAGCAATCAATTAGGTCAAAAAGAAAATATCTTGAAAAACAGTACTAAAATTAAATAATTTAAATGTAAAAGCAGCATAGATTAAAATACAAATTATGAGTAAAGAAATCATAAAAATGGCAATTAAAACTAAAAAAGTAAAACATCAGAGTTTTTTAACGAGAATCTGAATTGTACAGACTTATCATAAGATAATTATTTAGATTTTATCTAAGATTTTGATGAATTTTAATCTTTTTTAAATCCGTATTAGAAGTAGCATTCTATGAGGAACAGTAAGGATATCAGTGTTAGGCATAACATGGATTAAGCAAATTTAATTGATGAGATGAGTATTTTAAATATTTAATGTAATGAAATTGCCTCTTAAAAAAGTTCCACTAGAGTGTATTCGAAGCTAGTAAATAAATCTAAATCAAAGACAAGTTCTTCAAATAAAGAAGAAAAACAAAAACAAAATGATGCTTTTAAAGAAAATTAAATTGATATAGAATAGTCAGGTTAAATAATAGAAGAAAAAGTTCAAGAAAAACCATCCTTAAATGACTAAATAGATGCAAATAAAAATATATAATTCAGCTAATAAATTGAAAGCTTTTCTGATTTGAGTTAAAAATTTATTTCATAATAAAAAGAGGAGAGAACTCTTGAGGTTGCTAATCAATTCTATCTAGACACATCATTTTTACGGTCTCCATTAGAAATTAATGTTCTGTTTGATGTTTCTTACTTGCAATTTAATAAAGAAGAATAAGAATATTAATCTGTTTAATAAATAATACAATTAATTGACTTTTAAGAAGATAAATAAATGTTAGAAAAGCTATTTAATATAGATATTCTTTAAAATCATTACTTTATCTTTAACATATTTAATCTTTCTTATGTTAATAATCGTCAATACTAAGATTTACACACTATTCTCAACCAAAATCCTTCAACAAAAACATTCTTTTAAGTTCTGATTAATGTTTAAGAACAATTTATTAACCTTGGTATGTCATCTGAATTTTACACTCTAATATCTTAATTTTATTATAAAGTAATGTCAAACAAATAGAGGAATAACAAAATCTCTTATGATTTGTTAGACTCAGAAAGTTAAATAACAAGCTTAAACTACAGTCAAAATAAAAATTTTCTTGAAAAACTCATCGAATGCTTCCTAGGAATGTCTATATTTAAATAACTATCAAATGAAGATGTTATAGAAAATTTTCAATAAATGGTATTTGAGTATCTATTATTTAAATAATAAAATATTCCAACTTTGATAAATATTCACAATATAATCATAAACTACTTCCCAAATTAATGCTTAAATCTTATTGAATCTATTAAAAAATCTCTTAACTCTTTGAATATTTGCATTTGA