TTHERM_00120930

Length: 2439 bp

cDNA Sequence

ATGAGGACATTTGAGTTTAAAAAGAAGCAGTTTGGCAATAACTAAGCAAATAGTCAAGAATAGTAGAAATAATAGTGGCAGGAGATTTAGAAATAAAAGAAATAAAGAAAAGAAGAAGACATTTTAGTTGGAGAGAGAGGTGGTTTCTAGGGTTTTGATTAATGGGACTTTAAAGAATTGCCTATTGTATAGCACAAATAAGAGATTTTATATTGCGTAGAAAACTATTCTTGTGTGGTTGTAATTGCAGAAACAGGCTCAGGAAAAACAACAAAAATTCCTCAGTATTTGGTAGAAGCAGGATATGCTATAAATGGTAAAAAAATTGGGGTCAGTTAACCTAGAAGGATTGCAGCGATCAGTATTGCAAATAGAGTTGCTCAAGAAATGGGTTGTATTATTGGTTAAGAAGTTGGGTATAGTGTGAGATTCGATGATAATTGTGATGAGGAGCTCACTTAAATCAAATACATGACAGATGGTATGCTTATAAATTAAATTCTTAATGATCCCTTATTAAGTGAATACTCAGTGCTAATGATTGATGATATTCATGAAAGAAGTATAAACACTGATATCTTGTTAGGATTGTTAAAAAAAATCAGAAGAAAGAATCCACAGCTGAAATTAGTTATTTCTAGTGCTACTATTGATGCTGAAAGTATTAGCACCTTTTTCTAGGAAAGAGTAACAGATCCTAAAACAAATTAGGTTATTGCTAACCTCACTTCGTAAATTTTGTACATAGAAGGCAGACAATTTCCTGTAGATATTTATTACCTTAAAGAAACTACAAGAAATTATGTTGTGAAAGCCGTATAAGTCACTCTTGAAATCATAAGAGCTCCTGATAAAAAGGGAGATATCTTAATCTTTTTGACTGGTTAAGAAGAAATAGAAGCCTTTATCGAAATCATTTAAAAAAATTTTATTGGGGATGCTGAAAGATAAAATTTGAAAATACTTCCACTTTACTCTGGATTGCCTCTAGAGGACTAAATGGAGGTTTTTAAACCAAGTGAATCATATGTTAGAAAAATTATAGTCTCAACTAACATTGCTGAGTCCAGTATCACTATTAGTGGAGTAGTTTATGTTATAGATACCCTTTTTCACAAAATAAATTATTATGATTTTAAAAGAGGGTTTGAAAACCTTCTTGTTGTACCGATAAGCAAAGCTGCTGCTAAATAAAGAGCTGGAAGAGCTGGCAGAGTATAAAGAGGTGAATGCTATAGATTATGCACAAAAGATTAGTTTGTACAATTATACGATAACAGCACTCCAGAGATATTAAGATGTGATTTATCAACTTTCATTCTCTAGTTAAAAACACTTGGAGTAGGAGATGTCACTAACTTTGAATTACTTTAGTAGCCTAACGAAAATGCGTATGCAAAAGCATTAGAATAACTATTTGCTTTAAAGGTTATAGATAAATATTGCAATCTTACTTAAGAAATTGGACATAAAATATGTGATTTTAATCTTGAAACTAAGTTAGGAGTTCTATTATTGAATAGCTTTAAAGATGATTTTGGATGTAGTTAACAAATGCTTGTTTTATGTTCAATGCTCAGCTTGTAAGGTTAGGTATTTTACAATGGATTTGATCCAGCTACTATTTTGAAATAAAAGAAAAAATTAGGAGCTAAAGAAGGTGATCATATTACATTAATCAATATATTTTTAGCCTTTAATCACCTGAAAAGCTCACAAGCTAGACAAGGATTTTGTAGCGATCACAAACTAAATATAAAAAGCCTAAATATGGCAGTTAAAATACATGATTAGCTTTGCAAATAAGTTAAAAGAATGGGATTGAAGGTTAACAATAGTGAAGATGATATTGAGGGAATTTTGAGAGCTTTAGTTACAGCTTTCTTTATGAATGTTGCACAACTTTAACCTGATGGATCTTATAGAAATTTAAGAAATAAAGAAATTCTTTATCTTCACCCTACTTCAATACTTAACATAAATTTTCCTCAATGGGTCATATATTCTGAAGTTGTATTTTCAACAAAGTATTACATGAGAGAAGTTTCTGAAGTAGATCCAAAATGGTTGCTTGAATTAGCCAGCCATTATTTCGAAGATCAGAGATTAAAGTAAGCTGAGTAAAAGCATGGTAAAGAAATCATAGCACAAAATGAATATGAAAAAAACAAATAAAAAATTGAAGAAGAAAAATAAAAGGATCCAGTCATGGGTAGATTTAATATATTTAAAAGAAAAAGGCCTACAAATGTTATAGGTAGAGATGATGATAAAGAAAAAGAAGGATAGGAAAAGCTATAGAAAAAGCTAAAAATTAATCTACCACCCTCAAAACCTCAAAATACAAATTTATTATCATTTCAACAAGATGATGAAGAGGAAGAAGAGTATAATATAGAAGAAAGTGACGAAGACAATAATATTAAAGAAAATGAATGA