TTHERM_00122280

Length: 390 bp

cDNA Sequence

ATGAATAAAGGATTTTCATTAGCTCTTTAGGGTAAAAGTTTTCCTTCTTTTAAGTAAGAAGATGAATTATATGCAGGAGATACTATCAATTTTAAGTAAGGATAAGATGTAGAATGGGCAAAAAACGTGGTTTAAGATAGAACTGGATTAAGTCGCTCTGACTTTAAATTGTTTTTCGAAAATAAATAAATGATTGAAATACTTTCATTAAGTGATATACCTAATCTCAAAGACGGTAGCAAAGTTTAAGTAGTTGTAAGAATATGTTTAATATATATCTTTTTAATAAAATCAAAAGAAAGCTTTTTAACATATAAATAAGCAAATAACAAATATAAATAGAAATCTTAATAAAAAAATATTTTAAAATCTTTAAACATAACTGATTGA