TTHERM_00122460

Length: 735 bp

cDNA Sequence

ATGGCGAAATATATTAAGTACGGAATTTCTGCAACAATAATGTTTGGTATTGTCACATATGGTTCATACAAATACCACTAGATTAGATCATTTGAAGAAGAATATTATAAAAATTCGAATAGAAAAAGATAGTTTTTGTTTAATATACACTAAAACCTCGCTATTTTATATGATAAATCAGTGGATTCCTACGAAGATCTTTCAAAAATAAATTAATACCGCAAGATTCTTCTTTCTTATGCCTAAGGTTTTGTATTAGAAACAGCTATTGGAACTTCTAGAAACTTAAAATTCTATCCTCCTGGTGTCAAAGTGTTAGGAATAGATTGGAGTTCTAATATGTTAGAAGCAGCTATGCAAAAAAGTGTAAATCACATCTCTTACTCTTATAAAATAGATGATACTGAAAATTTAACATTTAAAGATAATGTATTTGATACTGTCGTTGATACTTTTGGATTAGAATATTATGTAAATCCTGATAAAGCACTTAAAGAAATGAAGAGAGTATGCAAAAAAGATGGGCTAATTTTAATTCTTGCAAGTGGTTAGAGTTTATACTAAGGACTTAATTTCTTTTTGAACTATAAAACTCCCTATACCGTTTGCAATTATGGATTCTTTCCCAACAGAAACTGGGAAGAATTCATCAAAGAAGAAGATTTTGAAATACTTAAAAAGGAAAGAAAAATAAATGGAACTGTATATATGTATGTCTTAAGAAATAAAAAATGA