TTHERM_00125280

Length: 1434 bp

cDNA Sequence

ATGTCTCAGAAAAAGAGTTTAAAATAAAAGAGAAAGTAAGACTATAGCTCTGATACTGAAGAGGAAGAAGAGGATCAATATGAAGTTGAAAAGATCTTAGACTCTAGATTTAATCCTAAGACCAAGCAAAAAGAATATCTTGTCAAATGGGAAAACTGGCCTATTGAAGACTCTACCTGGGAACCTTACGAGCATCTTTCGAATGTCAAAGAAATAGTTTAGGCCTTTGAAAAGAAGCAAAAAGCTAACGTTATGCCTCAACCTACTGGACCTATCACTAGAGTAAATGCCTAGAAAGACCCTTAAAAAAAGAACAGACTATCTTTGAATTCTTCTATCAGCAAATCTTTACCTCAAGAAGAAGAAATTTAGACATCTAAAGAAGACAGTAAAAAATAAGCAGTCAAAAAATTCCAACCAGCTTCAAGAAGAAAATCTATTAGTTCTTAATCTGATTCAGACCTTTAAGCTGAAGAAGTTCCACAGTAGCCTGAAAGTAAAAAAGATAAAAATGATGGTGCCTTTGAAGAACCCAACAATGCTGATGCAGACGAAACTGAGCTTGTATTTGAAGAAATTGTTGACAAAAGAATTCTTGATGGATAAACAGAATATTTAATACGCTTCTAAAATGTCTCTTAGCCATAATGGGTAGATGTTGGACAATTGATAGCTATTAAAGATGATGTTATAGCTTATGAAGATAAAATTGCTGCTTAGAGTTAGCTCAATAAGACTAAGAACTTGAAAGAAAATGCTAAACATTCATCTTAACAATAGCAAAGCGAAAATAATAACTTAGAGACGGAAGAAGTTGAAGAAGATAAAGATTCTAAAAAAAGAAGTTTACTTGCGAATTCAAAGAGACCCACTGCTAAAAGATCATAGCCATTCAATTAAGATGAAGAGAAAGAAAAATCAGTCACTTAGCCTACCTCGAATTTAGGAAGCAAAGGTCAATCTTAGTAAGTTGAAAAAGAACAAGCAACAAACTCACAAACTTAACAGCCTCAAACAGCACACAGAAGTGGCTCAAGACTCAGCTAGATTCAATCAAATGCCAATCAAGTTACTTAATAAGCTTAATAGCTATCAAACACCAACAATTCTTCCTCTACATCTCTTGAAGTTTCATCAAAAATGCCTAGCTAAATGTCTTAAAAACGCAGACCTATTGAACTTACTGAAATTTAACAAGGTGATTTCAAGACCGATAATGTCGATAAGATTGAAATCCAAGGAGATTTTAATGACATAATGACTTCAAGGTTTGAAGTTTTTTGGAAAATCAGATAAGACAATGTTACCCCTGCTTCCTAAGTCTATTCAGCCTCTTACCTGAGAAGATATGAGCCTTAAGTTCTCATCGATTTCCTCTTACAACATTCAAACTAATCTCAATTAAGACAAGCTAATTAATAACTTACTCATTGA