TTHERM_00128700

Length: 2619 bp

cDNA Sequence

ATGAATACCACAGCCTAGTCATTTAATACACATCAAAGCACGCAATAAAAAACTCCGCTGTCAGGACAAAAAAAACTCTAGTCAAGAAGAAATACAGGTTCTTCAAGTTTTAGATGCGCTTTTTAGGATACAATGTCTTCAACTAAGCCAGTTTTTAGAACTAATCAAAAGTTTTATTAGAATCAACCAAAAATTGATAAATTAATTGATTAATCTCCTTAAGCTTAAATTAAAAGAAAGGAAATAGAAATAAAATAATTATTAGAAAATTCTGCTTTGGCTAAATTTAAAGGTGATTTAGGTGAAGCACTAGAAATTGCAAAGTAAGCAGTTGAGCAAAGTAATAAACTGAAAATTCAGAAAGAGAAAGTTAACAACTATTATGAAGAAATTGACTTGCAATAGTATGATGTTCCATATAACTTAGCAATTTAACTTTAAGCTAATGGTTTCTATTAAGAAGCTCTTAAGTAATATACTTAAATATAATACAAAGATGCTATTAAAATGTATAAAAGAGCTTATCATATGACGTTTAGAGATTCTAAATATACAAGTATGCGTTTATAAATACTTAAAAATATCGGTATTGCTAATATAAAACAAGGAAAATATGAAGAAGCCATAAAAGACTTTGAAACTATTATGAATGAAAAACCAGACTTCTAAACTGCATTTAATTTAATTCTTTGCCTTTTTGAGTTGGGTGATAAATAAGGAATAAAAGACTGTTTTTCTTGTATGATAAATATTGAAATACCGGGTTACAATTAAAATGAACAAGAAGAAATAATTCAAGGAATAGCTTTAAATGATCCTTTAAGAGAGTATATAAAAGAGAAAAAAAAATAAGCTGTAGAAATAATAATAAGGAGTGCTAAATTTATAGCACCAATTATTCTAGACAATATTATAGATGGGTATAATTGGGTAATTGAAGCTTTAAAGGATTCTTATTTTTATGAGGCTTAAACAGAAATAGAAATATGCAAATCACTTGCTTATCTAGAAACCAAAGATATTGTTAATTCAATAGAAACACTCAAATAGTTTGAAAAAAGAGATAAAATTATTGTGGGAAGAGTCTCTAATAACATTTCTTTTCTTTATTTCTTAGAAAAGAATTTTAAAAATGCTGAGTAATATGCTGATTTAGCTATAGATTTTGATAGATTTAATCCTAAGGCTTTGGTCAATAGAGGAAACTGCTTTTTTGTTAAAAATGAATTTTAAAGATCTAAGCTATTATATTTAGATGCCCTCAGATATGATGCCTAATGCGCTGAGGCTCTTTACAACTTAGCTCTTGTGAATAAAAAGCTAAATATGCCTAATGAAGCTTTATTGGTATTAGAAAAATTATTGACTATCATTTCTACACCTGAAATCATTTATCAAGTGGCAAACATTTATGAATTGATGGGATAATCAAATTAAGCATTGAAATGGTATCAAATATTACTTACTTAAATACCTACAGAGGCTAATATTCTTGCAATTGTTGGTAGCATATATGCAAGGGAAAATAATGAATTACAAGCATTTACTTATTACAGTGAATCATTTAAATGTTGTTCTTATAAAATTGAAACAATAGAATGGCTAGGTTTATATTTTATAAAATAAGAGTTATATGAAAAGGCTTCATAAATATTTGAAAAGGCAATATAAATACAGCCAAAAGAAGCTAAATGGAAATTTATGGTGGCTTTTTGCTATAAAAAAATGGGGTTGAATAAGCTGACTCTTTAAATATATCAAGAAATCTATGAAAATGACCCTTAAAACATTGAATGTCTTAAATGTTTAATTCAAATATGTTAAGAGATGGGATTAAATAGTGAAGAATATGCTCAAGACATGAGAAAATTAGAAGCAAATCTTAATATTATTAGCTATTAAATTGATCACAATTAAGATTAAATGATTTAACCAAAATAATTTAATATATCAGCTGATTATGAAGGAAGATCAGAAAACTATCAGATTGATGTAAACTTTTAGTCAAGATAGTAGTTAAAGTTTTACTTATTTATTTGTCATGGTAGTTGTTCTCAAAAATTTTTAATTACATTTGAAATGAATTCTAACTAAAATATTGTTACTTGGGAAGATTTACTAGACCACTCAGATGAAAAAAGCTGTTATTTTATAATTGATGATACTGTTTATGATGTTACTGAGTTATTATCGTTATAGTCTAATTATAAAGAATTCTTGTTAAAAAACATAGGATAGATTAATAGAGAAGAGTAAGTAAAGTAATTCAATGAGAGTTTGTTTTTAATTTTGAAATAGCAAGGCAAAATAGTTGGAAATATAGAAAAAAAACCTTAAAGCGAATACTTTAAGAGAAAAGTTAGATTTTTAAAAGCTGAATATTAGGAGTTTACTTTAGAGGAAGTCTAAAAACACAATAAGATGCAAGATTTATGGGTAGTTTTAGATTAAAATGTTTATGACCTTACAGAATACTAGTTTATCCATCCTGGAAGACCTGATTCCATTCATCCATATGCTGGAAAAGATGCCACAGAAAAATTTAATTCTATTAATAAACATACAGAAGGAGCACGCAAATTTAGAGAGAATTATAAAATAGGAATTCTTAAAAAATGA