TTHERM_00128960

Length: 366 bp

cDNA Sequence

ATGGAATATCAAGGATAAGATTAAGCGAATGGGGATGGCTAAATGATAGACTACTAGGATTATAATTAATAAAATCAGCAGTAGATATAAGAATACGATTTTGAATTAGATATACCCTCAAAATACGAGCCTAATATGCTTATAGATTATATGGATAATACTGTAAATCACTACTTACTTTACAAGAAGATTGAATAGGAACCTTAATATTACTTAAATTTCGGGTTTGATTTAAAGGATTACGCTGCATTTTTGATAAAACAAACTTATATGAGAACTGAAAGAAAAGTAATTGAGGAGAAGATCAGAAAAATAAAAGGGGAGGATTAGCAAAAAGCATCAAATACTAACGAAGAATAAAGTTGA