TTHERM_00136240

Length: 918 bp

cDNA Sequence

ATGAATTTATTATTAAAAGCTAGCTAATATATTTCAAGAAATAGCTTCCCTGTTAATAACATTAGATCATTATTATAGGGTTCAGTCTATTCATTTTCTTCTTGCATTAAATAAAGACCAAATGATGTACCTACTCATAGAAACGAATTATTGCCTTTTACTTTAAACAACTTATGGAATAATCCAGGATATAGAAGAAAAGCTAAGAAATTAGGTAGAGGTATTGGATCCGGAAAGGGAAAAACTGCAGGAAAGGGTACTAACGGTCATAATAGTAGATCTGGTGGTGGTGTTTCTCCCAGATTTGAAGGTGGTCAAACTCCTTGGTTCAGAAGATTGCCTAAGTTAGGTATTACAAGAATAAATAAAGAACGTCCTAAAGCCATAAATATGAGTTTAATTATGTATGCTATTCACAAGGGAAGAATAGATTCTACTAAACCTATTACTATTAAAGTTCTTCACGATGCTGGTGTATTTAGTACTGCCAAATACGGTGTTAAATTAGTTGGTAGAGGTTTGAAAACAATTGATAGACCTCTTCATTTTGAAGTGAGTGATGCCTCTGAAAATGTTATTAAGGCTATAAAAGAAAAGGGTGGTAGTGTTAAGTGTATCTATAGAACTCCTCTTCAAATTAGAGAACACGTCTTCCCTCAAAATTATCCTATCAACTTAAGATCTACTATTCCTCCTAAGAGAATTGTTAAAAAAATGGAAAATATTAGAGAAAGAGGAGCCGAAGTAGAATTTAATGTTCCCAAATGGCACGAATAGAATGTTAAAGAAATCTTGGAAGATAAGAAGATCAAAGAAGAAGAATTTAATCTTCCTGTCCCAAGATTCCCAGGTTCTGGTAAAGATAAAATTAGAATTAGAAAGCCAATATTACCTAAGCAAATTAATTTCAAGATCTGA