TTHERM_00137990

Length: 1464 bp

cDNA Sequence

ATGATTCACTGTTTAAGAAACATTCGTACCGTCTCAGCCCTCCAAAGCAAGATTTCTTACAATCTTGGTGGTGGTAATAAAAGAAAGAAAACCTCAGGTGACTTGGATAATTATGATGTCCTTTTTGTAGGAGCTAATCTTGGTGGTATCTGCAGTAATCACTTCGACAAGGACACTCACGGTAAATACAAATGTTTCGTCTCTTTCGATCAACCTATAAATCAAATCTACTCTGTTCGTATTCCTTATGAATAATAAAGAGTCAGAAAGAGTGAATACATACATTTCTCCAAAAAATCTATCAATCAATTCACTCCTAGTGAAATGTTAGCAGTTAAGGAAATTTTACCTGAATAAAACGCTGTCGTTTTGAGCAGTGGTAGAAGAATCGGATACAACTAATTAGTTCTTGCCACTGGTCTTAAGCACGATTTCTCATAAATTAAAGGTTTTTATGAAGCTCTTGAACACCCTGAACATCCCGTTTACGCTAACAGAGATCCCGAAACATGGAGATCTGCTTAACACAAATATTCTAAGTATATTTCTAACTTCAAGAGTGGTGATGGTTACTTCTGCATTCCTGAATACCCCTATGCTGGTGAAGTTGAATGCTTCAACTTCTTCGTTTCTGACGAAGTATGGAAATGGGCTCAACACCATGGTGCTCTCTCTCCTAAGCACACTTTCACTATTGTTAATGCTAACGAAAAGTTTGTTCACTATTGTGACTCTGCTGATGCTTTCATTAAGGAAAGACTTGAAAAGAGAGGTATCAGAGTTGAATACAACACTAAGCTTCTCGGTATTGAATTAATTTAAATAAAAGTTCACCAAGATGGCTAAAAGGCTACCTTCATTAACACCAAGACTGGTGAAAAATCTGTTAGAGATTACAATAATTTATATTCTATCGTCCCCTCCAAGAGACAAGAATTCTTAGATAAGGCTGGTTTGACCAACGGTAACGGTTTGTTAAACGTTGATCACTAGACCTTGTAACACAAAAAATATAAAAATATCTTCGGTTTAGGTGATGCTGCTGATTTACCTACCACCAAGACTTTCTGGGCTGGCTGGTACTAAATCGCTGTTGTCAGAAACAACGTCAAGAGAAACCTTTAAGGTTAAACCTTGAATGCCCATTATGATGGTTTCTCTAAGGTTCCTCTTTTCACTGGTCACCAAACCCTTACTTACGTTGCTCACTCTTACGGTGGTGTTGGTAACTGGTAACATCTCAAGCACAACAACGGAGGTATTCTTGCTTGGATGAGATATCGTTCTTGGGCTAAGGGTATGGCCAAGAAATTCTAAGATTTCTACAATGGTGCTAGATTAGGTCCTCCCTACCACAAAGTTTTAAAGAGTTTCCCCGAACTTCCTGGAAGTCCCGAATCATAATAAAGCTCCGGTATTTCAAAGTACTTCCCTACTAAGACCGAAAATAAAGCTGCTCATTGA