TTHERM_00138050

Length: 1518 bp

cDNA Sequence

ATGGATTTATCAGAAATATTTACAAATTAATTTAAGATAATCCTAACATATACATATGAAAGATATAAATCAACAAAACTCTTTTTAAGTAAATTATAAAGTAATTCTTTGAATCATTCATAATTAGTTACTGCCTCTTATAGAATAAGATTAATTAACCAAAGAGATAAAAACCAAAAGCGTGTTCAAATGTTTGAAATTATTAGCAAAAATGCTAAATTAATAGGAGCTCTAGGCCTTATTGCATTAGGAGGCATAGTAAATTATGTTTTGTTTAAGGAAGATTCAGAGGAATAATAAAATTAAAATAAAATAAATGAAGAAAAATAAAATGAATAGCAAATGTAACAAAACTTAGGAATGACAAAAGATGAAGCAAAGGAAAAAATGCAAGAACTTTTATAAAAGGTTAAGAAATAGTCTGAAGAATAATTTAAGGAAGTAATCAAAAAAGATATAAAGGTAGAATATTATGGTTAATTCATTAGTGATAAAACTATTAAAATAATTATGCATAGAAGCGTTTTGTTTTGCATTGATTCACTTATGAAAATTCACTCCAAATTTATTGAGTAAAGATAAGAAAAGTATTATCAAATAGCTGAATATGCTGCTATTAATAACGAGTTGATTCAAAATTACTTCTATATTTTAAATATTTCTATGGAAAACATTACCCAAATCTTAGAAATTTCTCAAGAACTTTTCTAAAGTAGCTTGCGTTACTGGTAGACTTAGCAAAAAATCTCAAAGGGATATTTAAGAGATTTAGCATACCATTTTATGGCAGAAGCAAATATAAAAAACTCTATATCTAAAGACTAGTACATCGATTACTTGCAATTTGTGTGTGAGGAAATACCAAAGCAAGCAAACTAACTTAAGCTTTTACTTTCATAGTCAACTCCACAGCTTTAAAAGATAGTGATTCTTTCTAGAGCAGAAGATAAAGCCTTTTTTGATAAAAATATAAGTGATTTATAGGAAGTTATGAGTTCATAAAGTGGTTAGTAATCAAATAGTAATTTGAGTGAAAGATAGGTCTTTTAGGAATAAGACGATTAGAGAATCACAGGAGATGATTGGAAATTAGATTTAAGTTAAGAAGATAGGGATCTCGCTAATGAAGTCGAAGATAAGTTGAAAGAAGTATAAAAACAAATGGAAATTATAGAATAAAAAACAAAAATGCTCTAAAACAGAATGAATTTCCCATTTGGAGGTTCTGGAAGTATGCCAAATATGGAATAAATAGTTGACAAGTAGAGATAAGAATAGTAATAGACTTCTGATTCTCCAGAAGCCATGCCTATGCCACCTAAGATAGATTACAAAGATTTTCCTGTTATAGATTCAAGAGGAAACCTAGTTTAAAGTAGAGAACAAGTCATAGAAAGATACCACAATTCTCTTCCATTTATCAGATGTTTGGAATTACCATTCTGTTATGATAACAATAGAGCAGAAACAATTAAATACTTAAAATAAAAAATTTTAGCAAGTCAAAGAAGATAATGA