TTHERM_00145390

Length: 1401 bp

cDNA Sequence

ATGAGCTAGCTTACAATGGAACAATTATAACAAGCGTATGGTGGATTAACTTTAAACACCATGGATCACAAAATATATCCAGATTAGAAAGAGTTATCTAGAGGTCCAGGAACCGCTTGCTTTCTTAGATATAATAAAGAAAATCCTAATATCAAACCATTCGTTTATAAATACGCAGATTTTAAATCTGAAGAAGAAGGAGCCAGAATTAGATAAGAAGCAAATTATGGAATTCCCTTAATTAATAGAGAAAAGTATACTTAAAAGGTTATTGATTACGTCATTGGTAAAAACACTTTTCAAGGCTTTTATGAATACATAGAAGGAGAAAGTTTGTTTGACTACAGAGAAAGAAGAAAAGCTGAGTCAAATCCGATATTATATTAAGAAGCCGCAGCACTAACATTAGAAATATGGAAAATATTAGAGCCTTTGCATGCAAGAAATGTTAGTCATAAGAACATTAAACCTACAAATATTATTAGGAAAAAGTCGAATGGCAGGTTATACTTAGGGGATTTTAGCTTTGGTAACATCCTTTATGGTAAAATGCATTTTGGTATAAAATTTAATGAGTAAATGGCTTTGTACAATTTATGCTTTGATGCAGATGGTATGAATGAATCTACAATTGGTCTTAGACTAGATGGATATAGTTTAGTTATGCTTTTCTGTTCACTTTTAGGTAAAAAACTCTGCTTAGGATAGTTTAACAAAGGAAATCCAACAAATTTTATCAACATGTCAGGCCTTAATCCTCCAGTTCCTGATGTGGTAATAGATAACATCAAGTTTTTATCAATAGGAGATGCATTTGGAAACAGATAACCTTTAACAGAAGTTATTAGAATATTGAGCATGTGGTCTAACTCTGAAGCATAAATATTCAAATAAATATAGTATTAAGTATCAGATGAAATTAAAGCAATAGCAAATTTAGAAATAATGCCTGATAAAGTAATTATGATCCATCCGTGTTCAAATATTTCTGATGAGCAATTCTTTAGTTATATGACTTGCTTATATAACAAATAGAGATAACCTTACAAAAAAATTAATATACACTTTGGAGGGAATATGATAACTCAGCACTCATTTTTTAGAATGGTTGATGCGTTAGAAAATTTAAATACTTCAAATTTGAAAAATTTATCTATCTAAATGAATTACAATAATTTACAAAATATTTACAATTTTGTAATTAAGTTCAAGCAGCTTAAACTTCCTTGTCTTGAGAAGCTATCAATAGGATTCAAAGGAAATTGCAACACTTCAGAAAATGAATAAATACTCGACACTTTTTCTAAGCTAAGACAGAAGTATAAGTAAAAGATAAACTCAAAAGATCCTAAAAATAGAGAAAGATTTATAGTTAAATTCTCATAAGATATAGTCTCATGA