TTHERM_00145630

Length: 2535 bp

cDNA Sequence

ATGGAAAAGCAAGAAGAGCTTTTTGACAATAGAAATGAGTTTATAATAAAATCAACTTTGGATTTATCATAAAATAGTGATCAAGAATAAAAATTTTAATAAATAAGCTCAAAAATAAAAGAATAAGATGATGGGTCAAGCTATTTTGAAACAAAATATAATTATGATAAATAATTGTATTAGACACATAATATTCAAGAAAAGCATCAATTACTAAATTTTGTTAATGATGAAGAATAAAAGAGTGATTAATCATTATAGAATGAATTAAAAAATTTATAAAATGATTTAAATTAAGAGAATAATGCTATTTAAAATTTATAGCATAAAGAGAAAGTTTAAAATGAATGCTTAACTGAACAAATTCATGAAATTTATTTTCAAAAAATGGAAGGAAACAATATTTTGAGTGCAGATCAAAATTGTAATGATTAAATTGATGATTTTGAAGTTTAAGATAATTAAATCGTTGAAGAAATTAGTTATAAAAATTTAAGAATAGATTCTTTTTTTTAGTAAAATAAATTTATTGAGTTCTTCAAATAAAACAACTGGATTAAAATTACATTCATAAAAGAATAGATAGGTTCTTATACGAAAGCTTTACTATCTAAAATAGATGATGCATTATCAGAATGTAAAAAAATTTAAAAGCCTATTAGACTTTAACTAGAAGCTCATCAAATCAGCATACTTTTCTTAGTACCGTTGTGTAAAAGTCTAATTTCCTTTCCTAATTTAGTTAGCCTTTAACTAAATTTAAGCAAAAACTATTTAAATATGAATGCATTGCAGGATTTAGGGTAGGCAATATAATTAACAAGGAATGTAAGATTTTGGGATATAGATTTAAGTTATAATCCTAAGTTAGATAATATTGGACATCTAATACTCTAAGATTTGAGTTAGTTGAAATAATTAGAAAAATTATCAGTATCTTTGAATAATACTAGCTAAAATAGTTAGTGTGCTTTGTTTGCAGCAAAATGTGTCTGTAATAATAAACAAACTTTAAGATAAATAAACTTTTAATTTAGAAATTGCTTTTAAATTTCAGATGATTCTATTCGTTCTTTATTTAATTAAATATATGAAGTAGAATTAATTAGCTCGCTTGGATTAGGTTTAGATATGACAAATTTGACTTTGAATTTATCCTAATGTGAAATAAATAAAAGATAGTTTTAAAGTATCGCTATGTCTATTTACAATATGAGTTCAATTAAAAAACTCGAATTTGGCTGCTTTAGCTACAAATAAAACTCATTTATATAAGATACAATAGGAACAATACTTAAAAATAAATATATTTTAGATGATCTATAATTAGATTTGAGTGATAATTCCTTAGAAGATGATAACTTATATGAGCTAGTTTAGTGTTTAAAAAATTTACCTGCCTTAAAAAATGTAAAATTTAATTTATCAAAAAATTAATAATTTGGCAAAAGTGTTATCCATCTAGCAAATTTATTGAAAGAAAAAGAAATTAAAGGAAGTCTAGATCTAAGGTTTGTATAACCTTGCTATAATATTCAAGCTAGCAGTGCAATTAAAAGTAGTAGATAACCTTTCTAATTGACCCAAAAATCTATTAGAAACTTTTCTTCTATGGAATAATTGAAAAAGTTAAGAGATGAAACTGGTTCACCAATTGCTTAAGTTAAGAAAGCTCTTGACGAATTTGGTGGAGATTTTGAAAAAGCTAAGTAATTCTTGATTGAAAAAGGTTTGGCTTCAGCTCAAAAGAAATTAGATAAAGAAACTAGAGAAGGTGTTATTGGATTATATGTTTCTTAGAACAGAGACCTTGCAGTTATTGGTGAAGTTAACTGTGAAACTGACTTCGTTGCAAGAAGTGATTTATTCCTTGATTTCGTTCATTCTACTTTAAAAACTATTGTTGACTAAAAGAAGAACGTGAAGTTCAATGATGAATAAAAGGATCAAATTCTTTAATTCTTATAAAATAACACTCTTAACAAGGAGATCATTGAAGGAACAAAAAATGAAAATATGGATAAAGTTAGATAGTTAGTTATTTCTAAATTATAAGAAAATATCAACGTTAGAAGAGTTAGTACTGTAGAAATTTAAAATGGTGTTATTGGTTCTTATACTCACAACACATTAGCTGATAACATTGGAGCTAGAGCTTGCTTAGTCTCTTTAGAGGGAGCTAACTCCTCTGATGTTTCTAAATAATTAGCAGACAATATTGCTCTCTAAATTTTAGGTATGAAGCCAGATTACATTACTAAAGAAAATATCCCTGCTGATGTTCTCCAAAAAGAAATAGATAGAATTAAAGCTGAATTCGGAGATAGCTTAAAGGGTAAACCTTAAGCTGTTGTAGATAGAATGATTGAAGGAAAGCTTAAAAAATTCTATGAAGATAATGTCCTTTACGACCAAACATTACTTACTGACCAAGAAAAAGATGCAAAAACTATCGGCTAATTAATTAATGAATAATGCAAGCAACAAAACTCCTAAATTAAAATAAAAGAATACATCCTTTGGACTTGCAAATGA