TTHERM_00147560

Length: 576 bp

cDNA Sequence

ATGGACTCAGCTTTTGGTTTAGTAGGAAAAGATTTCGTAATTGTTGCCACTGACTGTTCAGTTGCTTATTCCATCCTTAAGTTGAAGGATAAGGAAGATAAAATCTCATTGTTAGATTAAAATAAAGTTATGGCTTTGAGCGGTGAACAAGCCTATCGTTTGTAATTCTCTGATTATATTGCTAAAAATATTGCTTTAAATAAATATCGTAACGGTACAGAATTTAACACCAAGGAATGTGCTGAGTTTGTTAGATCTGAACTAGCTTATGGTATCAGAAATGGTCCCTTCATGGTTAATTGTCTTATTGCAGGTTTTGATAATAATTAACCTTAATTATATTGGGTTGACTATATGGGAACTCTCGTTAAAAGTGTTAAAGCTGCTCATGGATATGCTGCTCACTTTGTTTTGAGTACACTCGATCATGACTACAAGCCCAATTTGACTTTAGATGAAGGAATAGCTATTATAAAGCGTTGCATCAATGAATTAAAAACAAGATTCTTGATTTCACAAAGCCATTTTATTGCTAAGATAGTCACTCCCGCTGGTATTTAAGTTCTTGAATTGTGA