TTHERM_00148700

Length: 738 bp

cDNA Sequence

ATGAACAGACCAAAAGGACCCTAACCAGAAGGAACAATTTCTCCAGAAGAAGCTGAAAAAAAATGGGGTGATAAATTTTATACATATACAGGCGTACCAAAAAAAGATATGCAAAAGGAAATAAATGAACTTGAAGAAAGTTTAGAAAGTGAAAAGATCAAAGGTTTAAAGAAATTCGAAGAAAGATTTGAGCTTAAAAAAATACAAATTGCTAAATCAAAGGAACATATATATAAGGGAGACGAAAAGGATAAGAAAATTCCTGTTGATGGAGACTTTGTTGAAGGTTCTAGAGTTTTTATGCAACATTGCTCAAGTTGTCATTCATTAGAAACAAATAACTAAGGTAGAAAAACTACTGGTCCTGCTTTAGGTTTAATTTATGGACGCAGAGCTGGTGCAGATCCATATTATAACTATAGCCCAAGCTTAGTTAAAAGTTCTTACGTATGGACAACACGCAATTTATTCTATTTCTTGCAAAATCCTCGTACTTTAATTAGTGGTAATAAATGTGAAATATTTGGAGGTGGTATTAAAAGTGAAGAAGAGAGAGCTGATCTTATAGAATTTTTAAAAGTTTATTCAAAATAGCTTTCTGAAAATTTGCGTCATAAAGCTAATAAAGTTTATGGAAAAGATTATGTTAATTATCACTTACAAACCTAATTACTTGTTGAATAAGAGGAAATGCGTCGTATCGGTATTGACGCTGCAAATGATGCAAAAAAAATATGA