TTHERM_00149000

Length: 480 bp

cDNA Sequence

ATGAGTAGCGAATAAAATAAAGACAAATCAGGTAACTCTTTAAAATCTGACACGATGATCAGTAATCTAATTGATGTTGAGGAAATCTATAAAAGTTAGAAATTGTATAAAGCTACTCCAAAGTTAGAAACAAAACCTATTCATTTAAAGCCTTTAGAATTATAATAAAAAAGTTTATTTGAAGCTTTTTTTAAGGGTGATCAAAAATACATATATGAATTTGATAAAGAAACACTACTTTATAGAGAAAAATATATAAGAAAATTAAGTTAATAAGGATTAACAGTTTGTCTATACACTGGAGGCATAAATTGGTTTGTATATTAATTCGTTTTTAAAAGCAGTTAACACAGCATTGCTACAAAAATAAGTAGCTTTACTATACTAAATGCTATACCTCTTAGTTATTTCGCTTACAAAATTCTAGTCGACTACAATAAAGCTAATGAGTTTTTGTTTGAAAGATATTTAAAATAATGA