TTHERM_00149110

Length: 621 bp

cDNA Sequence

ATGGAAAAGGACACTATTGCCACTTATAAAATCGTCTTAGTCGGAGATACAAGCGTTGGTAAAACCCATTTACTGAAGAGATACTCTAAAAACGAATTACCTAAAAACTCTGCTCCAACTATTGGTGTTGAATTTGGCACAAAGGAAGTAACTCTTAAGGATGGTACTAAAGTTAAGGCATAAATTTGGGATACAGCTGGTTAAGAAAGATATAGAGGAATCTTGAGTCTCCATTTCAGAAGAGCTGTTGGAGCTTTACTTGTTTATGATATCACTAAAGAAAAGACCTACAATTCTATAATGAAATGGATGGAAGATTTGAAGTATTTAGCCGATCCAGATATTGTTATTATGCTTGTAGGAAATAAACTTGATTTAGTTACAAAGACCTAAGAAAATCGTAAAGTTTCAATCGCTGAAGCTTAACAATTTGCCCTTGATAATAAACTTATTTTTAAAGAAACATCTGCTGTATTAGGAACTAATATTAAGGAAGTCTTTGAATAACTCCTTTAAGAAATATACAATTAAAAGAAAAAGAATCCTTAACCTTAGATACCTAACAATAATATAAAAGATTTAACAAGTACTTAAAGACAAAATGATGATTGTGCTTGCTGA