TTHERM_00150000

Length: 4107 bp

cDNA Sequence

ATGCCTCCTAAAAAGACTAAATCAAGCGAAGTAAAAGAAAGCAGATCTTCTTCTAAGAAAAATGTTATTGATTCTGAAGACAGTGAAGATCAAGCTATTAAGAAAACACCTAATACTAAAAAAGGATCAAATGCTGCAAATGCAAAAAGTGTTTTATCAAAAGAAAGCTCAGTTTAAAAAAGCAACTCATCAGATAATAAAAGAGCTTTAAAAAAAATCTAATTAAGTGAATCTGAGGGAGAAGATAAAGAGCTTTTTCCCACAGCACCTGCGAAAAAGAAATCTGCTCCTGCTCCCAAAGAAATTATAGTTAAGGAAGAAGAAAGTAGCGAAGATGATTAAGTTGTGAAAATTAAAAATAATAAAAATGGATCAGCTGCTGCTGCTACAACAACAAATAAAGTTGCTAAAAATAAAAAGAAAATTAGTGATAATGAATCTTGTGATGAAGAAGAAGAATAAATGACTAAAAATAAAAAAGCAACAAATTAAGCTAAAAATAAAAAAACTGACAAAGAAAATGAAACTAAGTAGACTACCTAACGCTCGTCAAGAAATTAGAAAAAGATTTCTTACAAAGAAGAAGATGAAGAAGACGAATACACTCCTGAATAAGAAGATGAAGATTTTAAGGATGAAGAAGTTGATGAAGTTGAAGAGGATGAAGAAGAAGGAGATGAGCTTAACTCAGATGATGATTTTGAAGAATAAGGCAAAAAGAATAAAAAGAATGGATAAAGAAAAAATAATAAAAAAGCAAATGGAAGAAGTGAAGGCGCAAATAATGAAAAAGCTGCTAAAAAAATTCATAAGGCTCCAGAAAATGCTGATGACAATCACATAATAGATGTATAAAAAGAATAAGGAAAATTGGATATAGAAGATTAATATGAATTGCCATACTTTTTAACAAAGAAGTATTTAAAAGATGCAGAAGGTAGACCAGTAGACGATCCTGAGTACGATCCATCAACTCTGTTTATCCCTATATAAGAGTTAAAAAAGGAAACACCTCTTTTCTAATTTGGAAGAAATTTTGTTTGCTTTTATACTGATGCCATTCTGATGAAAAAGCTCTTCGATTGCTATATTGGAGTCTGGGGCAAAAGACCTGTTGCTAATATTTTCGATAATCACTATCGTTTTTATGTAAAAGAACTTCTCGAAAAAGCAGATAAGTCTTGTTTAGTTGTAGATTAAGTTCAATTTTCAGATGATAGATCAAATGAATAATATCTTATTAAAAGAGAAGTTACCTAGATTATAACTAAGGGTACTTATACTGATTATGTAGATAATGTCGAAGATTATAATGCAAGATATTTAATGTGTATAGTAGAGAGTGAAACTGATCATTCATTTGGTTTAGTTCTTATAGATTGTACAACCCATCAAATATATTTAGATGATATCAAAAATGACCCAGCAGGAAACCAAATTCGTACAATTTTAAGAAAAATGAAACCTGTTGAAATTCACTCAGTCTTTAATAATCTTTCTGAATAAACTAAAAATATTTGCAAAACAACATGCAAACCATAATTTACATTTGATAAATCGTTTGAATTTTATGAGCTTTAAAGTATTTTCGAAGAGCTTAAAAATGAGTTTAGAGAGAAAATTCCAATTAATAATCCCGATAGTATGAAGAAAAGTAATTAAATGGAGATAGAAAAACCCAAGGCCAACAAGAAAAACAATAAAAAAAATAATAAAAAGAAATAAAGTGATGATGATGAAGATGGATCAGATGAAAGCTCTGATGAAGAAAAATCAAAAAGCTTAGTAGATGAAGAAGATGATGACGGAAGTGACAGTGAAGATGATATTGAAAACCTGTACAAGCCTGAAGTTAAAAAAGAGCCTAAATTTACTTACGGTGAACTTAGCAGCGATTATCCTTTACTATTGAAAGATATAGAGGAAATGTACAACATAGATAAAAAAAAATTTGAGGAAGAACTCTAAAAAAAAGCTAATAGGAAGCAAAAAAATTCTCAAGATATGTAAAATGAAGAAGATGATGATGAACCTTGCTTCGACATAGAATACCAGTATTATATGATGCTTTAAGCATTAATGCTTGGACTAAGCTACTTGAGAAAGCTGAAATTGAATGATAATGTATTTAGACTTGGTTCCTTTTCTCTTTTAGATTCAACTGTTTAAAAGAATACTTTTCTCCATTTAGATGCTCATGCAATAGAAAATTTAGATATTTTCGAGGTCAATTTATAAAACCGTGTTACTTCTGAAGGGTCTTTGATGTCTTTTATTGATTACACTAAAACTCAATTCGGAAAAAGAATGCTTAAGAGATGGCTATCTTATCCACTAAAAAGTATATAGCAAATAGAATAAAGGTAAGAAGCCATAGAAGATTTAATGAAAATAGAGGATGTAATTGAGTAATTTGATAAGAAACTCAGTAAATTAGGAGATGTCGAAAGATAAATTAGCAAAATTTTTAACTCATCTTAGAAATCAAGACTTAAACCTACTTCTTTTGAAAACTTCTCAAATGTCAGATTAAAAGATGCTTATTCTTTAGTTGAGGATTTAAAAAATTTAGAAGAAATTTTACTTATTTTCAAAGATTATTAAGACAATTTTAATTCAACTAAACTCAAAAAATTGGTTACTGTAAAGGATCCTGAATAAATTAATAAAATTTTAGAGAGTACCAGATAAAAAAATAACTCGTAAACCTATCTTTCATAAAAATTACTTAATAGGTAAAGCAGCACAAATAGTAAATCTAAGCAGTAAATTATAGTTGGTATTTTCCCAGACTTAAAGCCTTTTGTAGAGTTGATATAGAGTTAGCTCGAATAGGATGAATAAGGTTACTGCCAACCTAAATAAGGAGCAGATGCAGTTTATGATGAAATTGTATTTAAAATGAAAAAAATTTATAAGAAGATGAATAATGAAGCACTTGTCTGGCGTAAAAAATTTAACAATAACTAAGATATAAAATTAATAAAAAGCAAAATGTAATGGGAAATATAAATACCTGAGAAGCTTGTTGAAGGATCAAAGAAACCTAAAGAACTTTATCTCACTTCTAAAGTTAAAGGTTATCAAAGATTCTAAACAGATAAAATAATTAGTCTATGTGCAAAACTTAAAAAAGTAGAAGTCTAATTGCAAAAAGCCCTCTCTCCTTTTTGTGAAAGATTTTTCCATTTGTTTTATTAAAATAGAGAACTATTGTATTAGGCTGTTAATTGCATTGGTGAGTTAGATTGCTTATGCTCTTTGGCTAAGTGTTCTCTTAATCTTAAGATAAGATGCAAACCAACTTTTATTCCAGAAAGTTTAAATAAAAATGTTTTCGAACTTATAGAAATGTATCACCCCTAACTGCTAAAGGAAAATAAAAAAAATTTAGTACCAAATGATACAATTTTCGAAGATAATGTTACTTGTATGCTTGTCACAGGTCCAAATATGGGTGGTAAATCAACACTTCTTAGATAAAATTGCTTAGCTGTTATTCTAGCACAATTAGGTTGCTTCTTGCCTGCTAAAAGTTTTAAAACAATTATAAGAGACAGAATTTTCTGTAGAATAGGATTACTAGAAGGAAAATCAACCTTTTTGGTAGAAATGGAAGAGACAGGAGATATAGTGAAAGAGGCAACAAATTAAAGCTTGGTTTTATTAGATGAATTAGGAAGAGGTACAAGCACATTTGATGGTGTATCTATAGCATATGGTGTTTTGAGATATCTTGTTGAGAATGTTAAATGTCTTACCCTGTTTTCAACTCATTATCATATGCTTGTTGATGAATTTAAACTTTACAAAAATGTTCAATCCTATGTCATGGATTTTGATTACTGCTCATAATAAAAGAAAATAGATTTCAAATATAAATATATTAAAGGTTCTTCAGAAAAAAGTTTTGGTGTAAATGTAGCTAAAATGGCAGGACTTCCTGACAGTGTAATAGATAAAGCTCATAAAATGGAACATTATATGAATTCAGAAGATTAAAATATAGGTAATGTTCGTAGAATTACTTAAAAGTTTAATTCTATTATAGAAGCTTAGCATTAAAGTGACGATACACTTTTATAATTACTTAAAAATAGTTTTTGA